Incidental Mutation 'R9065:Sec24d'
ID 689191
Institutional Source Beutler Lab
Gene Symbol Sec24d
Ensembl Gene ENSMUSG00000039234
Gene Name Sec24 related gene family, member D (S. cerevisiae)
Synonyms 2310020L09Rik, LOC383951
Accession Numbers

Genbank: NM_027135; MGI: 1916858

Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9065 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 123267455-123365641 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 123355803 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 820 (Y820H)
Ref Sequence ENSEMBL: ENSMUSP00000035823 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047923]
AlphaFold Q6NXL1
Predicted Effect probably damaging
Transcript: ENSMUST00000047923
AA Change: Y820H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000035823
Gene: ENSMUSG00000039234
AA Change: Y820H

DomainStartEndE-ValueType
low complexity region 46 71 N/A INTRINSIC
low complexity region 75 87 N/A INTRINSIC
low complexity region 136 160 N/A INTRINSIC
low complexity region 197 222 N/A INTRINSIC
low complexity region 238 256 N/A INTRINSIC
Pfam:zf-Sec23_Sec24 360 398 1.8e-16 PFAM
Pfam:Sec23_trunk 437 681 3.6e-88 PFAM
Pfam:Sec23_BS 686 770 2e-20 PFAM
Pfam:Sec23_helical 783 884 1e-27 PFAM
Pfam:Gelsolin 899 974 4.2e-12 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SEC24 subfamily of the SEC23/SEC24 family, which is involved in vesicle trafficking. The encoded protein has similarity to yeast Sec24p component of COPII. COPII is the coat protein complex responsible for vesicle budding from the ER. This gene product is implicated in the shaping of the vesicle, and also in cargo selection and concentration. Mutations in this gene have been associated with Cole-Carpenter syndrome, a disorder affecting bone formation, resulting in craniofacial malformations and bones that break easily. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit early embryonic lethality. A hypomorphic gene trap allele results in lethality during organogenesis. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Gene trapped(5)

Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik T C 5: 113,175,218 N1472S probably benign Het
4930447C04Rik C A 12: 72,892,830 Q435H possibly damaging Het
Aass G T 6: 23,075,747 A797E probably benign Het
Ap3b1 T A 13: 94,471,715 Y565N probably damaging Het
Arid2 A G 15: 96,371,491 T1162A probably benign Het
Atp11b T C 3: 35,832,982 probably null Het
Card11 G A 5: 140,908,542 P111S probably damaging Het
Ccdc66 T A 14: 27,491,893 E328D probably damaging Het
Cldn8 T A 16: 88,563,014 M8L probably benign Het
Cnot9 T A 1: 74,518,983 L96* probably null Het
Cntnap5c T A 17: 58,138,647 C561S probably damaging Het
Dnah5 A G 15: 28,293,790 D1347G probably benign Het
Epb41 A G 4: 131,955,577 V390A Het
Ephb6 C T 6: 41,613,359 A15V probably benign Het
Eps15l1 G T 8: 72,391,918 S157* probably null Het
Ercc6l2 A G 13: 63,820,052 I155M possibly damaging Het
Esco1 G T 18: 10,594,005 T427K probably benign Het
Fam19a2 A G 10: 123,593,516 K12E probably benign Het
Fignl1 C T 11: 11,802,692 C121Y possibly damaging Het
Flrt2 A G 12: 95,779,403 S172G probably damaging Het
Frmd3 A T 4: 74,145,032 probably null Het
Fuz C T 7: 44,897,297 R119W probably damaging Het
Gm340 C T 19: 41,585,259 R818W probably damaging Het
Gm8765 A T 13: 50,702,240 H638L probably benign Het
Gtf2ird2 T G 5: 134,196,566 I165S probably damaging Het
Itih1 T A 14: 30,935,876 I417F probably damaging Het
Jarid2 G T 13: 44,840,850 V13L Het
Kndc1 C T 7: 139,927,795 S1222F possibly damaging Het
Lpp T A 16: 24,762,139 W327R probably benign Het
Msrb2 T A 2: 19,378,230 F56I possibly damaging Het
Muc16 A G 9: 18,643,009 I3996T unknown Het
Myh4 C A 11: 67,248,747 A630E probably benign Het
Nxt2 C T X: 142,237,751 A118V possibly damaging Het
Oacyl T A 18: 65,707,413 F85Y probably damaging Het
Olfr1474 T A 19: 13,471,306 I70N probably damaging Het
Olfr206 C T 16: 59,345,167 C178Y probably damaging Het
Olfr810 T A 10: 129,790,858 I244F possibly damaging Het
Pcdha11 A C 18: 37,006,824 E502A possibly damaging Het
Pcnx3 T C 19: 5,667,554 E1509G possibly damaging Het
Pfkm A T 15: 98,123,799 S314C probably damaging Het
Plch1 T C 3: 63,767,503 H230R probably damaging Het
Ppfia4 A T 1: 134,324,155 V427E possibly damaging Het
Ppox TCTTATACCTGGAC TC 1: 171,277,874 probably benign Het
Prr11 G A 11: 87,101,423 P209S probably damaging Het
Prrc2b C A 2: 32,219,292 Q1690K probably damaging Het
Rgs3 A T 4: 62,702,228 M564L probably benign Het
Six4 A C 12: 73,112,724 I154S possibly damaging Het
Spock3 A G 8: 63,348,955 K323E probably damaging Het
Stmn4 A T 14: 66,358,677 probably null Het
Tanc2 C T 11: 105,798,692 R227* probably null Het
Tcp1 T A 17: 12,920,323 V179D probably damaging Het
Trmt5 A T 12: 73,281,264 F388L probably damaging Het
Tsc2 G T 17: 24,603,190 P1126H probably benign Het
Ttn T A 2: 76,782,376 I17120F probably damaging Het
Ttn T G 2: 76,947,926 K1372N unknown Het
U2surp T C 9: 95,477,510 T652A probably benign Het
Utp20 A G 10: 88,757,110 V2239A probably benign Het
Vps33b A G 7: 80,285,591 T356A probably damaging Het
Vwf C A 6: 125,646,299 H1786Q Het
Wwox A G 8: 114,488,942 I152V probably benign Het
Ythdc2 A G 18: 44,844,351 T405A probably benign Het
Zfpm2 A T 15: 41,099,316 I257F possibly damaging Het
Other mutations in Sec24d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01420:Sec24d APN 3 123350009 missense probably benign 0.00
IGL01621:Sec24d APN 3 123294158 critical splice acceptor site probably null
IGL01866:Sec24d APN 3 123293595 nonsense probably null
IGL02064:Sec24d APN 3 123343814 splice site probably benign
IGL02125:Sec24d APN 3 123358958 missense probably damaging 1.00
IGL02173:Sec24d APN 3 123353681 missense probably damaging 1.00
IGL03239:Sec24d APN 3 123336489 missense probably benign 0.00
Scanty UTSW 3 123354947 missense probably damaging 1.00
3-1:Sec24d UTSW 3 123353630 missense possibly damaging 0.94
PIT4531001:Sec24d UTSW 3 123343178 missense probably damaging 1.00
R0008:Sec24d UTSW 3 123350876 splice site probably benign
R0838:Sec24d UTSW 3 123305836 missense probably benign 0.08
R1775:Sec24d UTSW 3 123336517 missense probably damaging 1.00
R1895:Sec24d UTSW 3 123353394 missense probably benign 0.04
R1946:Sec24d UTSW 3 123353394 missense probably benign 0.04
R2238:Sec24d UTSW 3 123349894 splice site probably null
R2504:Sec24d UTSW 3 123353606 missense possibly damaging 0.69
R2846:Sec24d UTSW 3 123350746 missense probably damaging 0.98
R2895:Sec24d UTSW 3 123343151 missense probably damaging 1.00
R3428:Sec24d UTSW 3 123343923 splice site probably benign
R4573:Sec24d UTSW 3 123358870 missense probably damaging 1.00
R4668:Sec24d UTSW 3 123355774 missense probably damaging 0.98
R4706:Sec24d UTSW 3 123355778 missense possibly damaging 0.80
R4896:Sec24d UTSW 3 123354947 missense probably damaging 1.00
R4982:Sec24d UTSW 3 123299606 missense probably benign 0.29
R5030:Sec24d UTSW 3 123358901 missense probably damaging 0.98
R5041:Sec24d UTSW 3 123294231 missense probably damaging 0.96
R5078:Sec24d UTSW 3 123290552 missense probably benign 0.00
R5108:Sec24d UTSW 3 123305785 splice site probably null
R5174:Sec24d UTSW 3 123364926 missense probably damaging 0.99
R5661:Sec24d UTSW 3 123343085 missense probably damaging 1.00
R5661:Sec24d UTSW 3 123343142 missense possibly damaging 0.95
R5775:Sec24d UTSW 3 123290460 missense probably benign 0.00
R5859:Sec24d UTSW 3 123279312 unclassified probably benign
R5944:Sec24d UTSW 3 123293581 missense probably benign 0.01
R6053:Sec24d UTSW 3 123279222 nonsense probably null
R6515:Sec24d UTSW 3 123343070 missense possibly damaging 0.92
R6552:Sec24d UTSW 3 123290552 missense probably benign 0.00
R6557:Sec24d UTSW 3 123343087 missense probably damaging 1.00
R6593:Sec24d UTSW 3 123353412 missense probably damaging 1.00
R6594:Sec24d UTSW 3 123293763 missense probably damaging 1.00
R6842:Sec24d UTSW 3 123343219 missense probably benign 0.00
R7072:Sec24d UTSW 3 123330351 missense probably damaging 1.00
R7481:Sec24d UTSW 3 123350763 missense probably damaging 1.00
R7554:Sec24d UTSW 3 123355774 missense probably damaging 1.00
R8270:Sec24d UTSW 3 123305886 missense possibly damaging 0.90
R8481:Sec24d UTSW 3 123353424 missense probably damaging 1.00
R8713:Sec24d UTSW 3 123343892 missense probably damaging 1.00
R8872:Sec24d UTSW 3 123354936 splice site probably benign
R8922:Sec24d UTSW 3 123350839 missense probably damaging 1.00
R8974:Sec24d UTSW 3 123305849 missense probably damaging 1.00
R9015:Sec24d UTSW 3 123327638 missense probably benign 0.43
R9050:Sec24d UTSW 3 123350725 missense probably benign 0.00
R9128:Sec24d UTSW 3 123294161 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTGCCTAGATCACACTACTCAAAAGAG -3'
(R):5'- CATGGCAACCTTATTTATATGCCTC -3'

Sequencing Primer
(F):5'- GCAGAGAGCATTATCCTTGTTTG -3'
(R):5'- GCACATTTTACAACGAAATACCTAGG -3'
Posted On 2021-11-19