Incidental Mutation 'R9065:Wwox'
ID 689206
Institutional Source Beutler Lab
Gene Symbol Wwox
Ensembl Gene ENSMUSG00000004637
Gene Name WW domain-containing oxidoreductase
Synonyms WOX1, 9030416C10Rik, 5330426P09Rik
MMRRC Submission 068890-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.907) question?
Stock # R9065 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 115166395-116079447 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 115215682 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 152 (I152V)
Ref Sequence ENSEMBL: ENSMUSP00000004756 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004756] [ENSMUST00000109108] [ENSMUST00000160862]
AlphaFold Q91WL8
Predicted Effect probably benign
Transcript: ENSMUST00000004756
AA Change: I152V

PolyPhen 2 Score 0.050 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000004756
Gene: ENSMUSG00000004637
AA Change: I152V

DomainStartEndE-ValueType
WW 17 49 3.31e-9 SMART
WW 58 90 5.76e-9 SMART
Pfam:KR 125 267 3e-9 PFAM
Pfam:adh_short 125 269 2.2e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109108
AA Change: I152V

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000104736
Gene: ENSMUSG00000004637
AA Change: I152V

DomainStartEndE-ValueType
WW 17 49 3.31e-9 SMART
WW 58 90 5.76e-9 SMART
Pfam:KR 125 267 1.4e-9 PFAM
Pfam:adh_short 125 270 4e-20 PFAM
Pfam:adh_short_C2 131 268 2.4e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160862
AA Change: I152V

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000125626
Gene: ENSMUSG00000004637
AA Change: I152V

DomainStartEndE-ValueType
WW 17 49 3.31e-9 SMART
WW 58 90 5.76e-9 SMART
Pfam:KR 125 267 1.3e-9 PFAM
Pfam:adh_short 125 270 3.7e-20 PFAM
Pfam:adh_short_C2 131 268 2.3e-8 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the short-chain dehydrogenases/reductases (SDR) protein family. This gene spans the FRA16D common chromosomal fragile site and appears to function as a tumor suppressor gene. Expression of the encoded protein is able to induce apoptosis, while defects in this gene are associated with multiple types of cancer. Disruption of this gene is also associated with autosomal recessive spinocerebellar ataxia 12. Disruption of a similar gene in mouse results in impaired steroidogenesis, additionally suggesting a metabolic function for the protein. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygous mutation of this gene results in premature death and increased incidence of tumor development. Reduced male fertility and testicular atrophy are also observed in mice with a hypomorphic allele. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik T C 5: 113,323,084 (GRCm39) N1472S probably benign Het
4930447C04Rik C A 12: 72,939,604 (GRCm39) Q435H possibly damaging Het
Aass G T 6: 23,075,746 (GRCm39) A797E probably benign Het
Ap3b1 T A 13: 94,608,223 (GRCm39) Y565N probably damaging Het
Arid2 A G 15: 96,269,372 (GRCm39) T1162A probably benign Het
Atp11b T C 3: 35,887,131 (GRCm39) probably null Het
Card11 G A 5: 140,894,297 (GRCm39) P111S probably damaging Het
Ccdc66 T A 14: 27,213,850 (GRCm39) E328D probably damaging Het
Cldn8 T A 16: 88,359,902 (GRCm39) M8L probably benign Het
Cnot9 T A 1: 74,558,142 (GRCm39) L96* probably null Het
Cntnap5c T A 17: 58,445,642 (GRCm39) C561S probably damaging Het
Dnah5 A G 15: 28,293,936 (GRCm39) D1347G probably benign Het
Epb41 A G 4: 131,682,888 (GRCm39) V390A Het
Ephb6 C T 6: 41,590,293 (GRCm39) A15V probably benign Het
Eps15l1 G T 8: 73,145,762 (GRCm39) S157* probably null Het
Ercc6l2 A G 13: 63,967,866 (GRCm39) I155M possibly damaging Het
Esco1 G T 18: 10,594,005 (GRCm39) T427K probably benign Het
Fignl1 C T 11: 11,752,692 (GRCm39) C121Y possibly damaging Het
Flrt2 A G 12: 95,746,177 (GRCm39) S172G probably damaging Het
Frmd3 A T 4: 74,063,269 (GRCm39) probably null Het
Fuz C T 7: 44,546,721 (GRCm39) R119W probably damaging Het
Gtf2ird2 T G 5: 134,225,407 (GRCm39) I165S probably damaging Het
Itih1 T A 14: 30,657,833 (GRCm39) I417F probably damaging Het
Jarid2 G T 13: 44,994,326 (GRCm39) V13L Het
Kndc1 C T 7: 139,507,708 (GRCm39) S1222F possibly damaging Het
Lcor C T 19: 41,573,698 (GRCm39) R818W probably damaging Het
Lpp T A 16: 24,580,889 (GRCm39) W327R probably benign Het
Msrb2 T A 2: 19,383,041 (GRCm39) F56I possibly damaging Het
Muc16 A G 9: 18,554,305 (GRCm39) I3996T unknown Het
Myh4 C A 11: 67,139,573 (GRCm39) A630E probably benign Het
Nxt2 C T X: 141,020,747 (GRCm39) A118V possibly damaging Het
Oacyl T A 18: 65,840,484 (GRCm39) F85Y probably damaging Het
Or5ac24 C T 16: 59,165,530 (GRCm39) C178Y probably damaging Het
Or5b118 T A 19: 13,448,670 (GRCm39) I70N probably damaging Het
Or6c69b T A 10: 129,626,727 (GRCm39) I244F possibly damaging Het
Pcdha11 A C 18: 37,139,877 (GRCm39) E502A possibly damaging Het
Pcnx3 T C 19: 5,717,582 (GRCm39) E1509G possibly damaging Het
Pfkm A T 15: 98,021,680 (GRCm39) S314C probably damaging Het
Plch1 T C 3: 63,674,924 (GRCm39) H230R probably damaging Het
Ppfia4 A T 1: 134,251,893 (GRCm39) V427E possibly damaging Het
Ppox TCTTATACCTGGAC TC 1: 171,105,447 (GRCm39) probably benign Het
Prr11 G A 11: 86,992,249 (GRCm39) P209S probably damaging Het
Prrc2b C A 2: 32,109,304 (GRCm39) Q1690K probably damaging Het
Rgs3 A T 4: 62,620,465 (GRCm39) M564L probably benign Het
Sec24d T C 3: 123,149,452 (GRCm39) Y820H probably damaging Het
Six4 A C 12: 73,159,498 (GRCm39) I154S possibly damaging Het
Spata31e4 A T 13: 50,856,276 (GRCm39) H638L probably benign Het
Spock3 A G 8: 63,801,989 (GRCm39) K323E probably damaging Het
Stmn4 A T 14: 66,596,126 (GRCm39) probably null Het
Tafa2 A G 10: 123,429,421 (GRCm39) K12E probably benign Het
Tanc2 C T 11: 105,689,518 (GRCm39) R227* probably null Het
Tcp1 T A 17: 13,139,210 (GRCm39) V179D probably damaging Het
Trmt5 A T 12: 73,328,038 (GRCm39) F388L probably damaging Het
Tsc2 G T 17: 24,822,164 (GRCm39) P1126H probably benign Het
Ttn T A 2: 76,612,720 (GRCm39) I17120F probably damaging Het
Ttn T G 2: 76,778,270 (GRCm39) K1372N unknown Het
U2surp T C 9: 95,359,563 (GRCm39) T652A probably benign Het
Utp20 A G 10: 88,592,972 (GRCm39) V2239A probably benign Het
Vps33b A G 7: 79,935,339 (GRCm39) T356A probably damaging Het
Vwf C A 6: 125,623,262 (GRCm39) H1786Q Het
Ythdc2 A G 18: 44,977,418 (GRCm39) T405A probably benign Het
Zfpm2 A T 15: 40,962,712 (GRCm39) I257F possibly damaging Het
Other mutations in Wwox
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01098:Wwox APN 8 115,172,118 (GRCm39) nonsense probably null
IGL02156:Wwox APN 8 115,174,899 (GRCm39) critical splice acceptor site probably null
IGL02267:Wwox APN 8 115,438,805 (GRCm39) missense probably benign 0.23
IGL02346:Wwox APN 8 115,438,858 (GRCm39) missense probably benign 0.11
IGL02350:Wwox APN 8 115,438,882 (GRCm39) missense possibly damaging 0.81
IGL02357:Wwox APN 8 115,438,882 (GRCm39) missense possibly damaging 0.81
IGL02586:Wwox APN 8 115,438,947 (GRCm39) missense possibly damaging 0.59
IGL02701:Wwox APN 8 115,433,108 (GRCm39) missense probably damaging 1.00
IGL02743:Wwox APN 8 116,078,443 (GRCm39) missense probably damaging 1.00
IGL02804:Wwox APN 8 115,438,753 (GRCm39) missense probably damaging 1.00
IGL02805:Wwox APN 8 115,438,753 (GRCm39) missense probably damaging 1.00
R0048:Wwox UTSW 8 115,166,570 (GRCm39) missense probably damaging 1.00
R0140:Wwox UTSW 8 115,433,027 (GRCm39) missense probably damaging 1.00
R0390:Wwox UTSW 8 115,433,018 (GRCm39) missense probably benign 0.08
R1146:Wwox UTSW 8 115,438,776 (GRCm39) missense probably damaging 1.00
R1146:Wwox UTSW 8 115,438,776 (GRCm39) missense probably damaging 1.00
R1193:Wwox UTSW 8 115,406,614 (GRCm39) missense probably benign
R1520:Wwox UTSW 8 115,438,873 (GRCm39) missense probably benign 0.36
R1552:Wwox UTSW 8 115,172,090 (GRCm39) nonsense probably null
R1628:Wwox UTSW 8 115,174,973 (GRCm39) missense probably benign
R1639:Wwox UTSW 8 115,172,118 (GRCm39) nonsense probably null
R3778:Wwox UTSW 8 115,601,347 (GRCm39) missense probably benign 0.00
R3967:Wwox UTSW 8 115,215,673 (GRCm39) missense probably damaging 1.00
R4077:Wwox UTSW 8 115,166,481 (GRCm39) utr 5 prime probably benign
R4876:Wwox UTSW 8 115,174,988 (GRCm39) missense probably damaging 1.00
R4936:Wwox UTSW 8 115,433,098 (GRCm39) missense probably benign 0.00
R5868:Wwox UTSW 8 115,406,586 (GRCm39) missense probably benign
R5988:Wwox UTSW 8 115,433,081 (GRCm39) missense probably benign 0.06
R6272:Wwox UTSW 8 115,215,692 (GRCm39) missense probably damaging 1.00
R7043:Wwox UTSW 8 115,406,578 (GRCm39) missense probably damaging 0.97
R7348:Wwox UTSW 8 115,199,392 (GRCm39) missense probably benign 0.00
R7815:Wwox UTSW 8 115,438,776 (GRCm39) missense probably damaging 1.00
R8119:Wwox UTSW 8 115,433,108 (GRCm39) missense probably damaging 1.00
R8324:Wwox UTSW 8 115,215,745 (GRCm39) critical splice donor site probably null
R8544:Wwox UTSW 8 115,215,646 (GRCm39) missense probably benign 0.08
R9183:Wwox UTSW 8 115,433,110 (GRCm39) missense probably damaging 1.00
R9187:Wwox UTSW 8 115,438,978 (GRCm39) missense probably damaging 0.97
R9525:Wwox UTSW 8 115,433,105 (GRCm39) missense probably benign 0.11
R9640:Wwox UTSW 8 115,166,540 (GRCm39) missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- GGACGGCTTTCTCACATCTTG -3'
(R):5'- GTTATTCCAAGAGCAGCGAAC -3'

Sequencing Primer
(F):5'- GCTCTGCTGTGCATCTAAAGTAAG -3'
(R):5'- CGAACTATACATGCAGCGTTG -3'
Posted On 2021-11-19