Mutagenetix > Incidental Mutation

Incidental Mutation 'R9065:Ap3b1'

689223

Institutional Source

Beutler Lab

Gene Symbol

Ap3b1

Ensembl Gene

ENSMUSG00000021686

Gene Name

adaptor-related protein complex 3, beta 1 subunit

Synonyms

recombination induced mutation 2, rim2, Hps2, beta3A, AP-3

MMRRC Submission

Accession Numbers

Ap3b1: Ncbi RefSeq: NM_009680; MGI: 1333879;

Essential gene?

Possibly non essential (E-score: 0.441) question?

Stock #

R9065 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

94358960-94566317 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 94471715 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Asparagine at position 565 (Y565N)

Ref Sequence

ENSEMBL: ENSMUSP00000022196 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022196]

AlphaFold

Q9Z1T1

Predicted Effect

probably damaging
Transcript: ENSMUST00000022196
AA Change: Y565N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000022196
Gene: ENSMUSG00000021686
AA Change: Y565N

Domain	Start	End	E-Value	Type
low complexity region	10	24	N/A	INTRINSIC
Pfam:Adaptin_N	39	586	1.2e-170	PFAM
Pfam:SEEEED	672	812	1.3e-27	PFAM
AP3B1_C	822	969	1.58e-78	SMART
Blast:B2	993	1103	2e-27	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000231916

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that may play a role in organelle biogenesis associated with melanosomes, platelet dense granules, and lysosomes. The encoded protein is part of the heterotetrameric AP-3 protein complex which interacts with the scaffolding protein clathrin. Mutations in this gene are associated with Hermansky-Pudlak syndrome type 2. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2012]
PHENOTYPE: Homozygous mutants exhibit hypopigmentation, elevated kidney levels of lysosomal enzymes, platelet storage pool deficiency, reduced ipsilateral projections from the retina to brain, reduced sensitivity of dark-adapted retina and shortened life span. [provided by MGI curators]

Allele List at MGI

All alleles(53) : Targeted(4) Gene trapped(34) Spontaneous(14) Chemically induced(1)

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2900026A02Rik	T	C	5: 113,175,218	N1472S	probably benign	Het
4930447C04Rik	C	A	12: 72,892,830	Q435H	possibly damaging	Het
Aass	G	T	6: 23,075,747	A797E	probably benign	Het
Arid2	A	G	15: 96,371,491	T1162A	probably benign	Het
Atp11b	T	C	3: 35,832,982		probably null	Het
Card11	G	A	5: 140,908,542	P111S	probably damaging	Het
Ccdc66	T	A	14: 27,491,893	E328D	probably damaging	Het
Cldn8	T	A	16: 88,563,014	M8L	probably benign	Het
Cnot9	T	A	1: 74,518,983	L96*	probably null	Het
Cntnap5c	T	A	17: 58,138,647	C561S	probably damaging	Het
Dnah5	A	G	15: 28,293,790	D1347G	probably benign	Het
Epb41	A	G	4: 131,955,577	V390A		Het
Ephb6	C	T	6: 41,613,359	A15V	probably benign	Het
Eps15l1	G	T	8: 72,391,918	S157*	probably null	Het
Ercc6l2	A	G	13: 63,820,052	I155M	possibly damaging	Het
Esco1	G	T	18: 10,594,005	T427K	probably benign	Het
Fam19a2	A	G	10: 123,593,516	K12E	probably benign	Het
Fignl1	C	T	11: 11,802,692	C121Y	possibly damaging	Het
Flrt2	A	G	12: 95,779,403	S172G	probably damaging	Het
Frmd3	A	T	4: 74,145,032		probably null	Het
Fuz	C	T	7: 44,897,297	R119W	probably damaging	Het
Gm340	C	T	19: 41,585,259	R818W	probably damaging	Het
Gm8765	A	T	13: 50,702,240	H638L	probably benign	Het
Gtf2ird2	T	G	5: 134,196,566	I165S	probably damaging	Het
Itih1	T	A	14: 30,935,876	I417F	probably damaging	Het
Jarid2	G	T	13: 44,840,850	V13L		Het
Kndc1	C	T	7: 139,927,795	S1222F	possibly damaging	Het
Lpp	T	A	16: 24,762,139	W327R	probably benign	Het
Msrb2	T	A	2: 19,378,230	F56I	possibly damaging	Het
Muc16	A	G	9: 18,643,009	I3996T	unknown	Het
Myh4	C	A	11: 67,248,747	A630E	probably benign	Het
Nxt2	C	T	X: 142,237,751	A118V	possibly damaging	Het
Oacyl	T	A	18: 65,707,413	F85Y	probably damaging	Het
Olfr1474	T	A	19: 13,471,306	I70N	probably damaging	Het
Olfr206	C	T	16: 59,345,167	C178Y	probably damaging	Het
Olfr810	T	A	10: 129,790,858	I244F	possibly damaging	Het
Pcdha11	A	C	18: 37,006,824	E502A	possibly damaging	Het
Pcnx3	T	C	19: 5,667,554	E1509G	possibly damaging	Het
Pfkm	A	T	15: 98,123,799	S314C	probably damaging	Het
Plch1	T	C	3: 63,767,503	H230R	probably damaging	Het
Ppfia4	A	T	1: 134,324,155	V427E	possibly damaging	Het
Ppox	TCTTATACCTGGAC	TC	1: 171,277,874		probably benign	Het
Prr11	G	A	11: 87,101,423	P209S	probably damaging	Het
Prrc2b	C	A	2: 32,219,292	Q1690K	probably damaging	Het
Rgs3	A	T	4: 62,702,228	M564L	probably benign	Het
Sec24d	T	C	3: 123,355,803	Y820H	probably damaging	Het
Six4	A	C	12: 73,112,724	I154S	possibly damaging	Het
Spock3	A	G	8: 63,348,955	K323E	probably damaging	Het
Stmn4	A	T	14: 66,358,677		probably null	Het
Tanc2	C	T	11: 105,798,692	R227*	probably null	Het
Tcp1	T	A	17: 12,920,323	V179D	probably damaging	Het
Trmt5	A	T	12: 73,281,264	F388L	probably damaging	Het
Tsc2	G	T	17: 24,603,190	P1126H	probably benign	Het
Ttn	T	A	2: 76,782,376	I17120F	probably damaging	Het
Ttn	T	G	2: 76,947,926	K1372N	unknown	Het
U2surp	T	C	9: 95,477,510	T652A	probably benign	Het
Utp20	A	G	10: 88,757,110	V2239A	probably benign	Het
Vps33b	A	G	7: 80,285,591	T356A	probably damaging	Het
Vwf	C	A	6: 125,646,299	H1786Q		Het
Wwox	A	G	8: 114,488,942	I152V	probably benign	Het
Ythdc2	A	G	18: 44,844,351	T405A	probably benign	Het
Zfpm2	A	T	15: 41,099,316	I257F	possibly damaging	Het

Other mutations in Ap3b1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00660:Ap3b1	APN	13	94390863	missense	probably damaging	1.00
IGL00766:Ap3b1	APN	13	94542884	splice site	probably benign
IGL01784:Ap3b1	APN	13	94493739	missense	probably damaging	1.00
IGL01979:Ap3b1	APN	13	94448463	nonsense	probably null
IGL02040:Ap3b1	APN	13	94408845	critical splice donor site	probably null
IGL02119:Ap3b1	APN	13	94462403	missense	probably benign	0.01
IGL02247:Ap3b1	APN	13	94394795	critical splice donor site	probably null
IGL02303:Ap3b1	APN	13	94528319	missense	unknown
IGL02493:Ap3b1	APN	13	94404020	missense	probably damaging	0.98
IGL02551:Ap3b1	APN	13	94418091	missense	probably damaging	0.99
IGL02651:Ap3b1	APN	13	94477021	missense	probably damaging	1.00
IGL02832:Ap3b1	APN	13	94528327	missense	unknown
IGL03033:Ap3b1	APN	13	94448495	missense	probably benign	0.15
IGL03101:Ap3b1	APN	13	94455398	missense	probably benign	0.00
bella	UTSW	13	94528257	missense	unknown
bullet_gray	UTSW	13	94451086	critical splice donor site	probably benign
cuttlefish	UTSW	13	94448451	critical splice acceptor site	probably null
Gastropod	UTSW	13	94542840	missense	unknown
razor	UTSW	13	94493731	missense	unknown
Slime	UTSW	13	94404078	missense	possibly damaging	0.51
slug	UTSW	13	94408845	critical splice donor site	probably null
snail	UTSW	13	94479885	splice site	probably benign
stalk	UTSW	13	94472931	critical splice donor site	probably null
R0034:Ap3b1	UTSW	13	94479885	splice site	probably benign
R0265:Ap3b1	UTSW	13	94493681	missense	unknown
R0270:Ap3b1	UTSW	13	94404118	splice site	probably benign
R0346:Ap3b1	UTSW	13	94445971	nonsense	probably null
R0422:Ap3b1	UTSW	13	94462460	missense	probably damaging	0.99
R0496:Ap3b1	UTSW	13	94472938	splice site	probably benign
R0508:Ap3b1	UTSW	13	94565714	missense	unknown
R0764:Ap3b1	UTSW	13	94479879	splice site	probably benign
R1506:Ap3b1	UTSW	13	94446143	splice site	probably benign
R1593:Ap3b1	UTSW	13	94501927	missense	unknown
R1660:Ap3b1	UTSW	13	94408812	missense	probably damaging	0.98
R1735:Ap3b1	UTSW	13	94493717	missense	unknown
R1791:Ap3b1	UTSW	13	94408797	missense	possibly damaging	0.63
R1818:Ap3b1	UTSW	13	94471704	missense	possibly damaging	0.48
R2280:Ap3b1	UTSW	13	94528216	missense	unknown
R3031:Ap3b1	UTSW	13	94565643	missense	unknown
R3037:Ap3b1	UTSW	13	94445978	critical splice donor site	probably null
R4401:Ap3b1	UTSW	13	94418099	missense	probably damaging	1.00
R4402:Ap3b1	UTSW	13	94418099	missense	probably damaging	1.00
R4403:Ap3b1	UTSW	13	94418099	missense	probably damaging	1.00
R4532:Ap3b1	UTSW	13	94565735	missense	unknown
R4624:Ap3b1	UTSW	13	94483226	missense	unknown
R4626:Ap3b1	UTSW	13	94404078	missense	possibly damaging	0.51
R4754:Ap3b1	UTSW	13	94403960	missense	probably damaging	1.00
R4788:Ap3b1	UTSW	13	94565641	missense	unknown
R4847:Ap3b1	UTSW	13	94471779	missense	probably benign	0.15
R4886:Ap3b1	UTSW	13	94472805	missense	possibly damaging	0.50
R5096:Ap3b1	UTSW	13	94479849	missense	unknown
R5628:Ap3b1	UTSW	13	94477048	missense	unknown
R5671:Ap3b1	UTSW	13	94528257	missense	unknown
R5677:Ap3b1	UTSW	13	94528196	missense	unknown
R5862:Ap3b1	UTSW	13	94547770	missense	unknown
R5941:Ap3b1	UTSW	13	94440273	missense	probably benign	0.02
R5941:Ap3b1	UTSW	13	94483265	missense	probably damaging	0.96
R6043:Ap3b1	UTSW	13	94476993	missense	probably benign	0.09
R6212:Ap3b1	UTSW	13	94451073	missense	probably damaging	1.00
R6212:Ap3b1	UTSW	13	94493699	missense	unknown
R6301:Ap3b1	UTSW	13	94528295	missense	unknown
R6765:Ap3b1	UTSW	13	94462509	missense	probably benign	0.02
R6812:Ap3b1	UTSW	13	94479861	missense	unknown
R6888:Ap3b1	UTSW	13	94408791	missense	probably benign	0.42
R6901:Ap3b1	UTSW	13	94418142	missense	probably benign	0.00
R7157:Ap3b1	UTSW	13	94532034	nonsense	probably null
R7422:Ap3b1	UTSW	13	94528165	missense	unknown
R7642:Ap3b1	UTSW	13	94477032	missense	probably benign	0.19
R7710:Ap3b1	UTSW	13	94451073	missense	probably damaging	1.00
R7757:Ap3b1	UTSW	13	94528158	splice site	probably null
R7867:Ap3b1	UTSW	13	94483263	missense	unknown
R8492:Ap3b1	UTSW	13	94394786	missense	possibly damaging	0.60
R8706:Ap3b1	UTSW	13	94408845	critical splice donor site	probably null
R8749:Ap3b1	UTSW	13	94528217	missense	unknown
R8876:Ap3b1	UTSW	13	94404078	missense	possibly damaging	0.51
R8889:Ap3b1	UTSW	13	94542840	missense	unknown
R8892:Ap3b1	UTSW	13	94542840	missense	unknown
R9152:Ap3b1	UTSW	13	94472931	critical splice donor site	probably null
R9152:Ap3b1	UTSW	13	94493731	missense	unknown
R9166:Ap3b1	UTSW	13	94471728	missense	probably damaging	1.00
R9218:Ap3b1	UTSW	13	94448451	critical splice acceptor site	probably null
R9269:Ap3b1	UTSW	13	94404062	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGAGGACATGTGCATTGGC -3'
(R):5'- AGCGTGCTGTAAGCTATGC -3'

Sequencing Primer
(F):5'- GTGCATTGGCTACAGAATTCC -3'
(R):5'- GCTGTAAGCTATGCATCTCGTGATAC -3'

Posted On

2021-11-19