Incidental Mutation 'R9065:Ap3b1'
ID 689223
Institutional Source Beutler Lab
Gene Symbol Ap3b1
Ensembl Gene ENSMUSG00000021686
Gene Name adaptor-related protein complex 3, beta 1 subunit
Synonyms AP-3, Hps2, beta3A, rim2, recombination induced mutation 2
MMRRC Submission 068890-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.320) question?
Stock # R9065 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 94495468-94702825 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 94608223 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Asparagine at position 565 (Y565N)
Ref Sequence ENSEMBL: ENSMUSP00000022196 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022196]
AlphaFold Q9Z1T1
Predicted Effect probably damaging
Transcript: ENSMUST00000022196
AA Change: Y565N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000022196
Gene: ENSMUSG00000021686
AA Change: Y565N

DomainStartEndE-ValueType
low complexity region 10 24 N/A INTRINSIC
Pfam:Adaptin_N 39 586 1.2e-170 PFAM
Pfam:SEEEED 672 812 1.3e-27 PFAM
AP3B1_C 822 969 1.58e-78 SMART
Blast:B2 993 1103 2e-27 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000231916
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that may play a role in organelle biogenesis associated with melanosomes, platelet dense granules, and lysosomes. The encoded protein is part of the heterotetrameric AP-3 protein complex which interacts with the scaffolding protein clathrin. Mutations in this gene are associated with Hermansky-Pudlak syndrome type 2. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2012]
PHENOTYPE: Homozygous mutants exhibit hypopigmentation, elevated kidney levels of lysosomal enzymes, platelet storage pool deficiency, reduced ipsilateral projections from the retina to brain, reduced sensitivity of dark-adapted retina and shortened life span. [provided by MGI curators]
Allele List at MGI

All alleles(53) : Targeted(4) Gene trapped(34) Spontaneous(14) Chemically induced(1)

Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik T C 5: 113,323,084 (GRCm39) N1472S probably benign Het
4930447C04Rik C A 12: 72,939,604 (GRCm39) Q435H possibly damaging Het
Aass G T 6: 23,075,746 (GRCm39) A797E probably benign Het
Arid2 A G 15: 96,269,372 (GRCm39) T1162A probably benign Het
Atp11b T C 3: 35,887,131 (GRCm39) probably null Het
Card11 G A 5: 140,894,297 (GRCm39) P111S probably damaging Het
Ccdc66 T A 14: 27,213,850 (GRCm39) E328D probably damaging Het
Cldn8 T A 16: 88,359,902 (GRCm39) M8L probably benign Het
Cnot9 T A 1: 74,558,142 (GRCm39) L96* probably null Het
Cntnap5c T A 17: 58,445,642 (GRCm39) C561S probably damaging Het
Dnah5 A G 15: 28,293,936 (GRCm39) D1347G probably benign Het
Epb41 A G 4: 131,682,888 (GRCm39) V390A Het
Ephb6 C T 6: 41,590,293 (GRCm39) A15V probably benign Het
Eps15l1 G T 8: 73,145,762 (GRCm39) S157* probably null Het
Ercc6l2 A G 13: 63,967,866 (GRCm39) I155M possibly damaging Het
Esco1 G T 18: 10,594,005 (GRCm39) T427K probably benign Het
Fignl1 C T 11: 11,752,692 (GRCm39) C121Y possibly damaging Het
Flrt2 A G 12: 95,746,177 (GRCm39) S172G probably damaging Het
Frmd3 A T 4: 74,063,269 (GRCm39) probably null Het
Fuz C T 7: 44,546,721 (GRCm39) R119W probably damaging Het
Gtf2ird2 T G 5: 134,225,407 (GRCm39) I165S probably damaging Het
Itih1 T A 14: 30,657,833 (GRCm39) I417F probably damaging Het
Jarid2 G T 13: 44,994,326 (GRCm39) V13L Het
Kndc1 C T 7: 139,507,708 (GRCm39) S1222F possibly damaging Het
Lcor C T 19: 41,573,698 (GRCm39) R818W probably damaging Het
Lpp T A 16: 24,580,889 (GRCm39) W327R probably benign Het
Msrb2 T A 2: 19,383,041 (GRCm39) F56I possibly damaging Het
Muc16 A G 9: 18,554,305 (GRCm39) I3996T unknown Het
Myh4 C A 11: 67,139,573 (GRCm39) A630E probably benign Het
Nxt2 C T X: 141,020,747 (GRCm39) A118V possibly damaging Het
Oacyl T A 18: 65,840,484 (GRCm39) F85Y probably damaging Het
Or5ac24 C T 16: 59,165,530 (GRCm39) C178Y probably damaging Het
Or5b118 T A 19: 13,448,670 (GRCm39) I70N probably damaging Het
Or6c69b T A 10: 129,626,727 (GRCm39) I244F possibly damaging Het
Pcdha11 A C 18: 37,139,877 (GRCm39) E502A possibly damaging Het
Pcnx3 T C 19: 5,717,582 (GRCm39) E1509G possibly damaging Het
Pfkm A T 15: 98,021,680 (GRCm39) S314C probably damaging Het
Plch1 T C 3: 63,674,924 (GRCm39) H230R probably damaging Het
Ppfia4 A T 1: 134,251,893 (GRCm39) V427E possibly damaging Het
Ppox TCTTATACCTGGAC TC 1: 171,105,447 (GRCm39) probably benign Het
Prr11 G A 11: 86,992,249 (GRCm39) P209S probably damaging Het
Prrc2b C A 2: 32,109,304 (GRCm39) Q1690K probably damaging Het
Rgs3 A T 4: 62,620,465 (GRCm39) M564L probably benign Het
Sec24d T C 3: 123,149,452 (GRCm39) Y820H probably damaging Het
Six4 A C 12: 73,159,498 (GRCm39) I154S possibly damaging Het
Spata31e4 A T 13: 50,856,276 (GRCm39) H638L probably benign Het
Spock3 A G 8: 63,801,989 (GRCm39) K323E probably damaging Het
Stmn4 A T 14: 66,596,126 (GRCm39) probably null Het
Tafa2 A G 10: 123,429,421 (GRCm39) K12E probably benign Het
Tanc2 C T 11: 105,689,518 (GRCm39) R227* probably null Het
Tcp1 T A 17: 13,139,210 (GRCm39) V179D probably damaging Het
Trmt5 A T 12: 73,328,038 (GRCm39) F388L probably damaging Het
Tsc2 G T 17: 24,822,164 (GRCm39) P1126H probably benign Het
Ttn T A 2: 76,612,720 (GRCm39) I17120F probably damaging Het
Ttn T G 2: 76,778,270 (GRCm39) K1372N unknown Het
U2surp T C 9: 95,359,563 (GRCm39) T652A probably benign Het
Utp20 A G 10: 88,592,972 (GRCm39) V2239A probably benign Het
Vps33b A G 7: 79,935,339 (GRCm39) T356A probably damaging Het
Vwf C A 6: 125,623,262 (GRCm39) H1786Q Het
Wwox A G 8: 115,215,682 (GRCm39) I152V probably benign Het
Ythdc2 A G 18: 44,977,418 (GRCm39) T405A probably benign Het
Zfpm2 A T 15: 40,962,712 (GRCm39) I257F possibly damaging Het
Other mutations in Ap3b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00660:Ap3b1 APN 13 94,527,371 (GRCm39) missense probably damaging 1.00
IGL00766:Ap3b1 APN 13 94,679,392 (GRCm39) splice site probably benign
IGL01784:Ap3b1 APN 13 94,630,247 (GRCm39) missense probably damaging 1.00
IGL01979:Ap3b1 APN 13 94,584,971 (GRCm39) nonsense probably null
IGL02040:Ap3b1 APN 13 94,545,353 (GRCm39) critical splice donor site probably null
IGL02119:Ap3b1 APN 13 94,598,911 (GRCm39) missense probably benign 0.01
IGL02247:Ap3b1 APN 13 94,531,303 (GRCm39) critical splice donor site probably null
IGL02303:Ap3b1 APN 13 94,664,827 (GRCm39) missense unknown
IGL02493:Ap3b1 APN 13 94,540,528 (GRCm39) missense probably damaging 0.98
IGL02551:Ap3b1 APN 13 94,554,599 (GRCm39) missense probably damaging 0.99
IGL02651:Ap3b1 APN 13 94,613,529 (GRCm39) missense probably damaging 1.00
IGL02832:Ap3b1 APN 13 94,664,835 (GRCm39) missense unknown
IGL03033:Ap3b1 APN 13 94,585,003 (GRCm39) missense probably benign 0.15
IGL03101:Ap3b1 APN 13 94,591,906 (GRCm39) missense probably benign 0.00
bella UTSW 13 94,664,765 (GRCm39) missense unknown
bullet_gray UTSW 13 94,587,594 (GRCm39) critical splice donor site probably benign
cuttlefish UTSW 13 94,584,959 (GRCm39) critical splice acceptor site probably null
Gastropod UTSW 13 94,679,348 (GRCm39) missense unknown
razor UTSW 13 94,630,239 (GRCm39) missense unknown
Slime UTSW 13 94,540,586 (GRCm39) missense possibly damaging 0.51
slug UTSW 13 94,545,353 (GRCm39) critical splice donor site probably null
snail UTSW 13 94,616,393 (GRCm39) splice site probably benign
stalk UTSW 13 94,609,439 (GRCm39) critical splice donor site probably null
R0034:Ap3b1 UTSW 13 94,616,393 (GRCm39) splice site probably benign
R0265:Ap3b1 UTSW 13 94,630,189 (GRCm39) missense unknown
R0270:Ap3b1 UTSW 13 94,540,626 (GRCm39) splice site probably benign
R0346:Ap3b1 UTSW 13 94,582,479 (GRCm39) nonsense probably null
R0422:Ap3b1 UTSW 13 94,598,968 (GRCm39) missense probably damaging 0.99
R0496:Ap3b1 UTSW 13 94,609,446 (GRCm39) splice site probably benign
R0508:Ap3b1 UTSW 13 94,702,222 (GRCm39) missense unknown
R0764:Ap3b1 UTSW 13 94,616,387 (GRCm39) splice site probably benign
R1506:Ap3b1 UTSW 13 94,582,651 (GRCm39) splice site probably benign
R1593:Ap3b1 UTSW 13 94,638,435 (GRCm39) missense unknown
R1660:Ap3b1 UTSW 13 94,545,320 (GRCm39) missense probably damaging 0.98
R1735:Ap3b1 UTSW 13 94,630,225 (GRCm39) missense unknown
R1791:Ap3b1 UTSW 13 94,545,305 (GRCm39) missense possibly damaging 0.63
R1818:Ap3b1 UTSW 13 94,608,212 (GRCm39) missense possibly damaging 0.48
R2280:Ap3b1 UTSW 13 94,664,724 (GRCm39) missense unknown
R3031:Ap3b1 UTSW 13 94,702,151 (GRCm39) missense unknown
R3037:Ap3b1 UTSW 13 94,582,486 (GRCm39) critical splice donor site probably null
R4401:Ap3b1 UTSW 13 94,554,607 (GRCm39) missense probably damaging 1.00
R4402:Ap3b1 UTSW 13 94,554,607 (GRCm39) missense probably damaging 1.00
R4403:Ap3b1 UTSW 13 94,554,607 (GRCm39) missense probably damaging 1.00
R4532:Ap3b1 UTSW 13 94,702,243 (GRCm39) missense unknown
R4624:Ap3b1 UTSW 13 94,619,734 (GRCm39) missense unknown
R4626:Ap3b1 UTSW 13 94,540,586 (GRCm39) missense possibly damaging 0.51
R4754:Ap3b1 UTSW 13 94,540,468 (GRCm39) missense probably damaging 1.00
R4788:Ap3b1 UTSW 13 94,702,149 (GRCm39) missense unknown
R4847:Ap3b1 UTSW 13 94,608,287 (GRCm39) missense probably benign 0.15
R4886:Ap3b1 UTSW 13 94,609,313 (GRCm39) missense possibly damaging 0.50
R5096:Ap3b1 UTSW 13 94,616,357 (GRCm39) missense unknown
R5628:Ap3b1 UTSW 13 94,613,556 (GRCm39) missense unknown
R5671:Ap3b1 UTSW 13 94,664,765 (GRCm39) missense unknown
R5677:Ap3b1 UTSW 13 94,664,704 (GRCm39) missense unknown
R5862:Ap3b1 UTSW 13 94,684,278 (GRCm39) missense unknown
R5941:Ap3b1 UTSW 13 94,619,773 (GRCm39) missense probably damaging 0.96
R5941:Ap3b1 UTSW 13 94,576,781 (GRCm39) missense probably benign 0.02
R6043:Ap3b1 UTSW 13 94,613,501 (GRCm39) missense probably benign 0.09
R6212:Ap3b1 UTSW 13 94,630,207 (GRCm39) missense unknown
R6212:Ap3b1 UTSW 13 94,587,581 (GRCm39) missense probably damaging 1.00
R6301:Ap3b1 UTSW 13 94,664,803 (GRCm39) missense unknown
R6765:Ap3b1 UTSW 13 94,599,017 (GRCm39) missense probably benign 0.02
R6812:Ap3b1 UTSW 13 94,616,369 (GRCm39) missense unknown
R6888:Ap3b1 UTSW 13 94,545,299 (GRCm39) missense probably benign 0.42
R6901:Ap3b1 UTSW 13 94,554,650 (GRCm39) missense probably benign 0.00
R7157:Ap3b1 UTSW 13 94,668,542 (GRCm39) nonsense probably null
R7422:Ap3b1 UTSW 13 94,664,673 (GRCm39) missense unknown
R7642:Ap3b1 UTSW 13 94,613,540 (GRCm39) missense probably benign 0.19
R7710:Ap3b1 UTSW 13 94,587,581 (GRCm39) missense probably damaging 1.00
R7757:Ap3b1 UTSW 13 94,664,666 (GRCm39) splice site probably null
R7867:Ap3b1 UTSW 13 94,619,771 (GRCm39) missense unknown
R8492:Ap3b1 UTSW 13 94,531,294 (GRCm39) missense possibly damaging 0.60
R8706:Ap3b1 UTSW 13 94,545,353 (GRCm39) critical splice donor site probably null
R8749:Ap3b1 UTSW 13 94,664,725 (GRCm39) missense unknown
R8876:Ap3b1 UTSW 13 94,540,586 (GRCm39) missense possibly damaging 0.51
R8889:Ap3b1 UTSW 13 94,679,348 (GRCm39) missense unknown
R8892:Ap3b1 UTSW 13 94,679,348 (GRCm39) missense unknown
R9152:Ap3b1 UTSW 13 94,630,239 (GRCm39) missense unknown
R9152:Ap3b1 UTSW 13 94,609,439 (GRCm39) critical splice donor site probably null
R9166:Ap3b1 UTSW 13 94,608,236 (GRCm39) missense probably damaging 1.00
R9218:Ap3b1 UTSW 13 94,584,959 (GRCm39) critical splice acceptor site probably null
R9269:Ap3b1 UTSW 13 94,540,570 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGGACATGTGCATTGGC -3'
(R):5'- AGCGTGCTGTAAGCTATGC -3'

Sequencing Primer
(F):5'- GTGCATTGGCTACAGAATTCC -3'
(R):5'- GCTGTAAGCTATGCATCTCGTGATAC -3'
Posted On 2021-11-19