Mutagenetix > Incidental Mutation

Incidental Mutation 'R9065:Zfpm2'

689228

Institutional Source

Beutler Lab

Gene Symbol

Zfpm2

Ensembl Gene

ENSMUSG00000022306

Gene Name

zinc finger protein, multitype 2

Synonyms

B330005D23Rik, FOG2, FOG-2

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R9065 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

40655035-41104592 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 41099316 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 257 (I257F)

Ref Sequence

ENSEMBL: ENSMUSP00000051335 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053467] [ENSMUST00000230319]

AlphaFold

Q8CCH7

Predicted Effect

possibly damaging
Transcript: ENSMUST00000053467
AA Change: I257F

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000051335
Gene: ENSMUSG00000022306
AA Change: I257F

Domain	Start	End	E-Value	Type
low complexity region	19	35	N/A	INTRINSIC
ZnF_C2H2	250	270	4.27e1	SMART
ZnF_C2H2	296	320	1.25e-1	SMART
ZnF_C2H2	335	357	4.05e-1	SMART
ZnF_C2H2	363	385	6.23e-2	SMART
ZnF_C2H2	548	569	1.43e1	SMART
ZnF_C2H2	687	714	1.06e2	SMART
low complexity region	731	741	N/A	INTRINSIC
ZnF_C2H2	854	874	5.4e1	SMART
ZnF_C2H2	1119	1145	4.99e1	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000230319
AA Change: I125F

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The zinc finger protein encoded by this gene is a widely expressed member of the FOG family of transcription factors. The family members modulate the activity of GATA family proteins, which are important regulators of hematopoiesis and cardiogenesis in mammals. It has been demonstrated that the protein can both activate and down-regulate expression of GATA-target genes, suggesting different modulation in different promoter contexts. A related mRNA suggests an alternatively spliced product but this information is not yet fully supported by the sequence. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit cardiac defects, including absence of coronary vasculature, resulting in lethality between E12.5 and E15.5. Conditional mutations reveal errors in ovary and testis development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2900026A02Rik	T	C	5: 113,175,218	N1472S	probably benign	Het
4930447C04Rik	C	A	12: 72,892,830	Q435H	possibly damaging	Het
Aass	G	T	6: 23,075,747	A797E	probably benign	Het
Ap3b1	T	A	13: 94,471,715	Y565N	probably damaging	Het
Arid2	A	G	15: 96,371,491	T1162A	probably benign	Het
Atp11b	T	C	3: 35,832,982		probably null	Het
Card11	G	A	5: 140,908,542	P111S	probably damaging	Het
Ccdc66	T	A	14: 27,491,893	E328D	probably damaging	Het
Cldn8	T	A	16: 88,563,014	M8L	probably benign	Het
Cnot9	T	A	1: 74,518,983	L96*	probably null	Het
Cntnap5c	T	A	17: 58,138,647	C561S	probably damaging	Het
Dnah5	A	G	15: 28,293,790	D1347G	probably benign	Het
Epb41	A	G	4: 131,955,577	V390A		Het
Ephb6	C	T	6: 41,613,359	A15V	probably benign	Het
Eps15l1	G	T	8: 72,391,918	S157*	probably null	Het
Ercc6l2	A	G	13: 63,820,052	I155M	possibly damaging	Het
Esco1	G	T	18: 10,594,005	T427K	probably benign	Het
Fam19a2	A	G	10: 123,593,516	K12E	probably benign	Het
Fignl1	C	T	11: 11,802,692	C121Y	possibly damaging	Het
Flrt2	A	G	12: 95,779,403	S172G	probably damaging	Het
Frmd3	A	T	4: 74,145,032		probably null	Het
Fuz	C	T	7: 44,897,297	R119W	probably damaging	Het
Gm340	C	T	19: 41,585,259	R818W	probably damaging	Het
Gm8765	A	T	13: 50,702,240	H638L	probably benign	Het
Gtf2ird2	T	G	5: 134,196,566	I165S	probably damaging	Het
Itih1	T	A	14: 30,935,876	I417F	probably damaging	Het
Jarid2	G	T	13: 44,840,850	V13L		Het
Kndc1	C	T	7: 139,927,795	S1222F	possibly damaging	Het
Lpp	T	A	16: 24,762,139	W327R	probably benign	Het
Msrb2	T	A	2: 19,378,230	F56I	possibly damaging	Het
Muc16	A	G	9: 18,643,009	I3996T	unknown	Het
Myh4	C	A	11: 67,248,747	A630E	probably benign	Het
Nxt2	C	T	X: 142,237,751	A118V	possibly damaging	Het
Oacyl	T	A	18: 65,707,413	F85Y	probably damaging	Het
Olfr1474	T	A	19: 13,471,306	I70N	probably damaging	Het
Olfr206	C	T	16: 59,345,167	C178Y	probably damaging	Het
Olfr810	T	A	10: 129,790,858	I244F	possibly damaging	Het
Pcdha11	A	C	18: 37,006,824	E502A	possibly damaging	Het
Pcnx3	T	C	19: 5,667,554	E1509G	possibly damaging	Het
Pfkm	A	T	15: 98,123,799	S314C	probably damaging	Het
Plch1	T	C	3: 63,767,503	H230R	probably damaging	Het
Ppfia4	A	T	1: 134,324,155	V427E	possibly damaging	Het
Ppox	TCTTATACCTGGAC	TC	1: 171,277,874		probably benign	Het
Prr11	G	A	11: 87,101,423	P209S	probably damaging	Het
Prrc2b	C	A	2: 32,219,292	Q1690K	probably damaging	Het
Rgs3	A	T	4: 62,702,228	M564L	probably benign	Het
Sec24d	T	C	3: 123,355,803	Y820H	probably damaging	Het
Six4	A	C	12: 73,112,724	I154S	possibly damaging	Het
Spock3	A	G	8: 63,348,955	K323E	probably damaging	Het
Stmn4	A	T	14: 66,358,677		probably null	Het
Tanc2	C	T	11: 105,798,692	R227*	probably null	Het
Tcp1	T	A	17: 12,920,323	V179D	probably damaging	Het
Trmt5	A	T	12: 73,281,264	F388L	probably damaging	Het
Tsc2	G	T	17: 24,603,190	P1126H	probably benign	Het
Ttn	T	A	2: 76,782,376	I17120F	probably damaging	Het
Ttn	T	G	2: 76,947,926	K1372N	unknown	Het
U2surp	T	C	9: 95,477,510	T652A	probably benign	Het
Utp20	A	G	10: 88,757,110	V2239A	probably benign	Het
Vps33b	A	G	7: 80,285,591	T356A	probably damaging	Het
Vwf	C	A	6: 125,646,299	H1786Q		Het
Wwox	A	G	8: 114,488,942	I152V	probably benign	Het
Ythdc2	A	G	18: 44,844,351	T405A	probably benign	Het

Other mutations in Zfpm2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00473:Zfpm2	APN	15	41099287	missense	probably damaging	1.00
IGL00815:Zfpm2	APN	15	41099491	missense	probably benign	0.37
IGL00821:Zfpm2	APN	15	41103387	missense	probably damaging	1.00
IGL01622:Zfpm2	APN	15	41101924	missense	probably benign	0.07
IGL01623:Zfpm2	APN	15	41101924	missense	probably benign	0.07
IGL01807:Zfpm2	APN	15	40753056	critical splice donor site	probably null
IGL01872:Zfpm2	APN	15	41102387	missense	probably benign
IGL02087:Zfpm2	APN	15	41103121	missense	probably damaging	0.97
IGL02123:Zfpm2	APN	15	41102195	missense	probably damaging	1.00
IGL02355:Zfpm2	APN	15	41099494	missense	probably damaging	1.00
IGL02362:Zfpm2	APN	15	41099494	missense	probably damaging	1.00
IGL02579:Zfpm2	APN	15	41099472	missense	possibly damaging	0.91
IGL02752:Zfpm2	APN	15	41102019	missense	probably benign	0.23
IGL02792:Zfpm2	APN	15	41103013	missense	probably benign	0.00
IGL02861:Zfpm2	APN	15	41103266	missense	probably damaging	0.98
IGL03180:Zfpm2	APN	15	41101394	missense	probably damaging	1.00
IGL03344:Zfpm2	APN	15	41102774	missense	probably benign
R0305:Zfpm2	UTSW	15	40774035	splice site	probably benign
R0365:Zfpm2	UTSW	15	40774066	missense	possibly damaging	0.88
R1171:Zfpm2	UTSW	15	41101679	missense	probably damaging	1.00
R1456:Zfpm2	UTSW	15	41102481	missense	probably damaging	1.00
R1482:Zfpm2	UTSW	15	41099291	missense	probably damaging	1.00
R1580:Zfpm2	UTSW	15	41103209	missense	possibly damaging	0.84
R2119:Zfpm2	UTSW	15	41103023	missense	probably damaging	1.00
R2189:Zfpm2	UTSW	15	41101183	missense	possibly damaging	0.76
R2867:Zfpm2	UTSW	15	41099389	missense	probably benign	0.06
R2867:Zfpm2	UTSW	15	41099389	missense	probably benign	0.06
R2886:Zfpm2	UTSW	15	41102323	missense	probably benign	0.44
R3024:Zfpm2	UTSW	15	41102959	missense	probably benign	0.00
R4043:Zfpm2	UTSW	15	40870627	missense	possibly damaging	0.94
R4178:Zfpm2	UTSW	15	41103544	missense	probably damaging	1.00
R4465:Zfpm2	UTSW	15	41096161	missense	probably benign	0.00
R5263:Zfpm2	UTSW	15	41099395	missense	probably benign	0.45
R5266:Zfpm2	UTSW	15	41099469	missense	probably benign	0.01
R5352:Zfpm2	UTSW	15	40870542	missense	probably benign	0.01
R5584:Zfpm2	UTSW	15	41102537	missense	probably benign	0.45
R5661:Zfpm2	UTSW	15	41096071	nonsense	probably null
R6437:Zfpm2	UTSW	15	41099397	missense	probably benign
R6660:Zfpm2	UTSW	15	40655585	critical splice donor site	probably null
R6742:Zfpm2	UTSW	15	41101718	missense	probably benign
R6749:Zfpm2	UTSW	15	40954708	missense	possibly damaging	0.90
R7363:Zfpm2	UTSW	15	40753017	missense	probably damaging	1.00
R7401:Zfpm2	UTSW	15	41102990	missense	possibly damaging	0.87
R7657:Zfpm2	UTSW	15	41103275	missense	possibly damaging	0.78
R7690:Zfpm2	UTSW	15	40954766	missense	possibly damaging	0.45
R7698:Zfpm2	UTSW	15	41096091	missense	probably benign	0.03
R7893:Zfpm2	UTSW	15	41102612	missense	probably damaging	1.00
R8081:Zfpm2	UTSW	15	41102248	missense	probably damaging	1.00
R8223:Zfpm2	UTSW	15	40752959	missense	probably benign	0.34
R9028:Zfpm2	UTSW	15	41103362	missense	possibly damaging	0.87
R9234:Zfpm2	UTSW	15	41103074	missense	probably damaging	1.00
R9474:Zfpm2	UTSW	15	41103471	missense	probably damaging	1.00
R9694:Zfpm2	UTSW	15	41102314	missense	possibly damaging	0.88

Predicted Primers

PCR Primer
(F):5'- CTGAACAGTCCTTGGGAACTTG -3'
(R):5'- AGCTCGGGCATTGGAAAAGC -3'

Sequencing Primer
(F):5'- CAGTCCTTGGGAACTTGACTTACAG -3'
(R):5'- CTCGGGCATTGGAAAAGCTCTTG -3'

Posted On

2021-11-19