Incidental Mutation 'R9065:Zfpm2'
ID 689228
Institutional Source Beutler Lab
Gene Symbol Zfpm2
Ensembl Gene ENSMUSG00000022306
Gene Name zinc finger protein, multitype 2
Synonyms B330005D23Rik, FOG2, FOG-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9065 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 40655035-41104592 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 41099316 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 257 (I257F)
Ref Sequence ENSEMBL: ENSMUSP00000051335 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053467] [ENSMUST00000230319]
AlphaFold Q8CCH7
Predicted Effect possibly damaging
Transcript: ENSMUST00000053467
AA Change: I257F

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000051335
Gene: ENSMUSG00000022306
AA Change: I257F

DomainStartEndE-ValueType
low complexity region 19 35 N/A INTRINSIC
ZnF_C2H2 250 270 4.27e1 SMART
ZnF_C2H2 296 320 1.25e-1 SMART
ZnF_C2H2 335 357 4.05e-1 SMART
ZnF_C2H2 363 385 6.23e-2 SMART
ZnF_C2H2 548 569 1.43e1 SMART
ZnF_C2H2 687 714 1.06e2 SMART
low complexity region 731 741 N/A INTRINSIC
ZnF_C2H2 854 874 5.4e1 SMART
ZnF_C2H2 1119 1145 4.99e1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000230319
AA Change: I125F

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The zinc finger protein encoded by this gene is a widely expressed member of the FOG family of transcription factors. The family members modulate the activity of GATA family proteins, which are important regulators of hematopoiesis and cardiogenesis in mammals. It has been demonstrated that the protein can both activate and down-regulate expression of GATA-target genes, suggesting different modulation in different promoter contexts. A related mRNA suggests an alternatively spliced product but this information is not yet fully supported by the sequence. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit cardiac defects, including absence of coronary vasculature, resulting in lethality between E12.5 and E15.5. Conditional mutations reveal errors in ovary and testis development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik T C 5: 113,175,218 N1472S probably benign Het
4930447C04Rik C A 12: 72,892,830 Q435H possibly damaging Het
Aass G T 6: 23,075,747 A797E probably benign Het
Ap3b1 T A 13: 94,471,715 Y565N probably damaging Het
Arid2 A G 15: 96,371,491 T1162A probably benign Het
Atp11b T C 3: 35,832,982 probably null Het
Card11 G A 5: 140,908,542 P111S probably damaging Het
Ccdc66 T A 14: 27,491,893 E328D probably damaging Het
Cldn8 T A 16: 88,563,014 M8L probably benign Het
Cnot9 T A 1: 74,518,983 L96* probably null Het
Cntnap5c T A 17: 58,138,647 C561S probably damaging Het
Dnah5 A G 15: 28,293,790 D1347G probably benign Het
Epb41 A G 4: 131,955,577 V390A Het
Ephb6 C T 6: 41,613,359 A15V probably benign Het
Eps15l1 G T 8: 72,391,918 S157* probably null Het
Ercc6l2 A G 13: 63,820,052 I155M possibly damaging Het
Esco1 G T 18: 10,594,005 T427K probably benign Het
Fam19a2 A G 10: 123,593,516 K12E probably benign Het
Fignl1 C T 11: 11,802,692 C121Y possibly damaging Het
Flrt2 A G 12: 95,779,403 S172G probably damaging Het
Frmd3 A T 4: 74,145,032 probably null Het
Fuz C T 7: 44,897,297 R119W probably damaging Het
Gm340 C T 19: 41,585,259 R818W probably damaging Het
Gm8765 A T 13: 50,702,240 H638L probably benign Het
Gtf2ird2 T G 5: 134,196,566 I165S probably damaging Het
Itih1 T A 14: 30,935,876 I417F probably damaging Het
Jarid2 G T 13: 44,840,850 V13L Het
Kndc1 C T 7: 139,927,795 S1222F possibly damaging Het
Lpp T A 16: 24,762,139 W327R probably benign Het
Msrb2 T A 2: 19,378,230 F56I possibly damaging Het
Muc16 A G 9: 18,643,009 I3996T unknown Het
Myh4 C A 11: 67,248,747 A630E probably benign Het
Nxt2 C T X: 142,237,751 A118V possibly damaging Het
Oacyl T A 18: 65,707,413 F85Y probably damaging Het
Olfr1474 T A 19: 13,471,306 I70N probably damaging Het
Olfr206 C T 16: 59,345,167 C178Y probably damaging Het
Olfr810 T A 10: 129,790,858 I244F possibly damaging Het
Pcdha11 A C 18: 37,006,824 E502A possibly damaging Het
Pcnx3 T C 19: 5,667,554 E1509G possibly damaging Het
Pfkm A T 15: 98,123,799 S314C probably damaging Het
Plch1 T C 3: 63,767,503 H230R probably damaging Het
Ppfia4 A T 1: 134,324,155 V427E possibly damaging Het
Ppox TCTTATACCTGGAC TC 1: 171,277,874 probably benign Het
Prr11 G A 11: 87,101,423 P209S probably damaging Het
Prrc2b C A 2: 32,219,292 Q1690K probably damaging Het
Rgs3 A T 4: 62,702,228 M564L probably benign Het
Sec24d T C 3: 123,355,803 Y820H probably damaging Het
Six4 A C 12: 73,112,724 I154S possibly damaging Het
Spock3 A G 8: 63,348,955 K323E probably damaging Het
Stmn4 A T 14: 66,358,677 probably null Het
Tanc2 C T 11: 105,798,692 R227* probably null Het
Tcp1 T A 17: 12,920,323 V179D probably damaging Het
Trmt5 A T 12: 73,281,264 F388L probably damaging Het
Tsc2 G T 17: 24,603,190 P1126H probably benign Het
Ttn T A 2: 76,782,376 I17120F probably damaging Het
Ttn T G 2: 76,947,926 K1372N unknown Het
U2surp T C 9: 95,477,510 T652A probably benign Het
Utp20 A G 10: 88,757,110 V2239A probably benign Het
Vps33b A G 7: 80,285,591 T356A probably damaging Het
Vwf C A 6: 125,646,299 H1786Q Het
Wwox A G 8: 114,488,942 I152V probably benign Het
Ythdc2 A G 18: 44,844,351 T405A probably benign Het
Other mutations in Zfpm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00473:Zfpm2 APN 15 41099287 missense probably damaging 1.00
IGL00815:Zfpm2 APN 15 41099491 missense probably benign 0.37
IGL00821:Zfpm2 APN 15 41103387 missense probably damaging 1.00
IGL01622:Zfpm2 APN 15 41101924 missense probably benign 0.07
IGL01623:Zfpm2 APN 15 41101924 missense probably benign 0.07
IGL01807:Zfpm2 APN 15 40753056 critical splice donor site probably null
IGL01872:Zfpm2 APN 15 41102387 missense probably benign
IGL02087:Zfpm2 APN 15 41103121 missense probably damaging 0.97
IGL02123:Zfpm2 APN 15 41102195 missense probably damaging 1.00
IGL02355:Zfpm2 APN 15 41099494 missense probably damaging 1.00
IGL02362:Zfpm2 APN 15 41099494 missense probably damaging 1.00
IGL02579:Zfpm2 APN 15 41099472 missense possibly damaging 0.91
IGL02752:Zfpm2 APN 15 41102019 missense probably benign 0.23
IGL02792:Zfpm2 APN 15 41103013 missense probably benign 0.00
IGL02861:Zfpm2 APN 15 41103266 missense probably damaging 0.98
IGL03180:Zfpm2 APN 15 41101394 missense probably damaging 1.00
IGL03344:Zfpm2 APN 15 41102774 missense probably benign
R0305:Zfpm2 UTSW 15 40774035 splice site probably benign
R0365:Zfpm2 UTSW 15 40774066 missense possibly damaging 0.88
R1171:Zfpm2 UTSW 15 41101679 missense probably damaging 1.00
R1456:Zfpm2 UTSW 15 41102481 missense probably damaging 1.00
R1482:Zfpm2 UTSW 15 41099291 missense probably damaging 1.00
R1580:Zfpm2 UTSW 15 41103209 missense possibly damaging 0.84
R2119:Zfpm2 UTSW 15 41103023 missense probably damaging 1.00
R2189:Zfpm2 UTSW 15 41101183 missense possibly damaging 0.76
R2867:Zfpm2 UTSW 15 41099389 missense probably benign 0.06
R2867:Zfpm2 UTSW 15 41099389 missense probably benign 0.06
R2886:Zfpm2 UTSW 15 41102323 missense probably benign 0.44
R3024:Zfpm2 UTSW 15 41102959 missense probably benign 0.00
R4043:Zfpm2 UTSW 15 40870627 missense possibly damaging 0.94
R4178:Zfpm2 UTSW 15 41103544 missense probably damaging 1.00
R4465:Zfpm2 UTSW 15 41096161 missense probably benign 0.00
R5263:Zfpm2 UTSW 15 41099395 missense probably benign 0.45
R5266:Zfpm2 UTSW 15 41099469 missense probably benign 0.01
R5352:Zfpm2 UTSW 15 40870542 missense probably benign 0.01
R5584:Zfpm2 UTSW 15 41102537 missense probably benign 0.45
R5661:Zfpm2 UTSW 15 41096071 nonsense probably null
R6437:Zfpm2 UTSW 15 41099397 missense probably benign
R6660:Zfpm2 UTSW 15 40655585 critical splice donor site probably null
R6742:Zfpm2 UTSW 15 41101718 missense probably benign
R6749:Zfpm2 UTSW 15 40954708 missense possibly damaging 0.90
R7363:Zfpm2 UTSW 15 40753017 missense probably damaging 1.00
R7401:Zfpm2 UTSW 15 41102990 missense possibly damaging 0.87
R7657:Zfpm2 UTSW 15 41103275 missense possibly damaging 0.78
R7690:Zfpm2 UTSW 15 40954766 missense possibly damaging 0.45
R7698:Zfpm2 UTSW 15 41096091 missense probably benign 0.03
R7893:Zfpm2 UTSW 15 41102612 missense probably damaging 1.00
R8081:Zfpm2 UTSW 15 41102248 missense probably damaging 1.00
R8223:Zfpm2 UTSW 15 40752959 missense probably benign 0.34
R9028:Zfpm2 UTSW 15 41103362 missense possibly damaging 0.87
R9234:Zfpm2 UTSW 15 41103074 missense probably damaging 1.00
R9474:Zfpm2 UTSW 15 41103471 missense probably damaging 1.00
R9694:Zfpm2 UTSW 15 41102314 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- CTGAACAGTCCTTGGGAACTTG -3'
(R):5'- AGCTCGGGCATTGGAAAAGC -3'

Sequencing Primer
(F):5'- CAGTCCTTGGGAACTTGACTTACAG -3'
(R):5'- CTCGGGCATTGGAAAAGCTCTTG -3'
Posted On 2021-11-19