Incidental Mutation 'R9065:Or5b118'
ID 689242
Institutional Source Beutler Lab
Gene Symbol Or5b118
Ensembl Gene ENSMUSG00000096273
Gene Name olfactory receptor family 5 subfamily B member 118
Synonyms Olfr1474, MOR202-26P, GA_x6K02T2RE5P-3803583-3804527, MOR202-42
MMRRC Submission 068890-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.070) question?
Stock # R9065 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 13448336-13449280 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 13448670 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 70 (I70N)
Ref Sequence ENSEMBL: ENSMUSP00000147143 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096202] [ENSMUST00000207529] [ENSMUST00000220113]
AlphaFold Q7TQQ8
Predicted Effect probably damaging
Transcript: ENSMUST00000096202
AA Change: I112N

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000093916
Gene: ENSMUSG00000096273
AA Change: I112N

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 1.6e-52 PFAM
Pfam:7TM_GPCR_Srsx 33 303 1e-7 PFAM
Pfam:7tm_1 39 288 8.7e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000207529
AA Change: I70N

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000220113
AA Change: I112N

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI

none

Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik T C 5: 113,323,084 (GRCm39) N1472S probably benign Het
4930447C04Rik C A 12: 72,939,604 (GRCm39) Q435H possibly damaging Het
Aass G T 6: 23,075,746 (GRCm39) A797E probably benign Het
Ap3b1 T A 13: 94,608,223 (GRCm39) Y565N probably damaging Het
Arid2 A G 15: 96,269,372 (GRCm39) T1162A probably benign Het
Atp11b T C 3: 35,887,131 (GRCm39) probably null Het
Card11 G A 5: 140,894,297 (GRCm39) P111S probably damaging Het
Ccdc66 T A 14: 27,213,850 (GRCm39) E328D probably damaging Het
Cldn8 T A 16: 88,359,902 (GRCm39) M8L probably benign Het
Cnot9 T A 1: 74,558,142 (GRCm39) L96* probably null Het
Cntnap5c T A 17: 58,445,642 (GRCm39) C561S probably damaging Het
Dnah5 A G 15: 28,293,936 (GRCm39) D1347G probably benign Het
Epb41 A G 4: 131,682,888 (GRCm39) V390A Het
Ephb6 C T 6: 41,590,293 (GRCm39) A15V probably benign Het
Eps15l1 G T 8: 73,145,762 (GRCm39) S157* probably null Het
Ercc6l2 A G 13: 63,967,866 (GRCm39) I155M possibly damaging Het
Esco1 G T 18: 10,594,005 (GRCm39) T427K probably benign Het
Fignl1 C T 11: 11,752,692 (GRCm39) C121Y possibly damaging Het
Flrt2 A G 12: 95,746,177 (GRCm39) S172G probably damaging Het
Frmd3 A T 4: 74,063,269 (GRCm39) probably null Het
Fuz C T 7: 44,546,721 (GRCm39) R119W probably damaging Het
Gtf2ird2 T G 5: 134,225,407 (GRCm39) I165S probably damaging Het
Itih1 T A 14: 30,657,833 (GRCm39) I417F probably damaging Het
Jarid2 G T 13: 44,994,326 (GRCm39) V13L Het
Kndc1 C T 7: 139,507,708 (GRCm39) S1222F possibly damaging Het
Lcor C T 19: 41,573,698 (GRCm39) R818W probably damaging Het
Lpp T A 16: 24,580,889 (GRCm39) W327R probably benign Het
Msrb2 T A 2: 19,383,041 (GRCm39) F56I possibly damaging Het
Muc16 A G 9: 18,554,305 (GRCm39) I3996T unknown Het
Myh4 C A 11: 67,139,573 (GRCm39) A630E probably benign Het
Nxt2 C T X: 141,020,747 (GRCm39) A118V possibly damaging Het
Oacyl T A 18: 65,840,484 (GRCm39) F85Y probably damaging Het
Or5ac24 C T 16: 59,165,530 (GRCm39) C178Y probably damaging Het
Or6c69b T A 10: 129,626,727 (GRCm39) I244F possibly damaging Het
Pcdha11 A C 18: 37,139,877 (GRCm39) E502A possibly damaging Het
Pcnx3 T C 19: 5,717,582 (GRCm39) E1509G possibly damaging Het
Pfkm A T 15: 98,021,680 (GRCm39) S314C probably damaging Het
Plch1 T C 3: 63,674,924 (GRCm39) H230R probably damaging Het
Ppfia4 A T 1: 134,251,893 (GRCm39) V427E possibly damaging Het
Ppox TCTTATACCTGGAC TC 1: 171,105,447 (GRCm39) probably benign Het
Prr11 G A 11: 86,992,249 (GRCm39) P209S probably damaging Het
Prrc2b C A 2: 32,109,304 (GRCm39) Q1690K probably damaging Het
Rgs3 A T 4: 62,620,465 (GRCm39) M564L probably benign Het
Sec24d T C 3: 123,149,452 (GRCm39) Y820H probably damaging Het
Six4 A C 12: 73,159,498 (GRCm39) I154S possibly damaging Het
Spata31e4 A T 13: 50,856,276 (GRCm39) H638L probably benign Het
Spock3 A G 8: 63,801,989 (GRCm39) K323E probably damaging Het
Stmn4 A T 14: 66,596,126 (GRCm39) probably null Het
Tafa2 A G 10: 123,429,421 (GRCm39) K12E probably benign Het
Tanc2 C T 11: 105,689,518 (GRCm39) R227* probably null Het
Tcp1 T A 17: 13,139,210 (GRCm39) V179D probably damaging Het
Trmt5 A T 12: 73,328,038 (GRCm39) F388L probably damaging Het
Tsc2 G T 17: 24,822,164 (GRCm39) P1126H probably benign Het
Ttn T A 2: 76,612,720 (GRCm39) I17120F probably damaging Het
Ttn T G 2: 76,778,270 (GRCm39) K1372N unknown Het
U2surp T C 9: 95,359,563 (GRCm39) T652A probably benign Het
Utp20 A G 10: 88,592,972 (GRCm39) V2239A probably benign Het
Vps33b A G 7: 79,935,339 (GRCm39) T356A probably damaging Het
Vwf C A 6: 125,623,262 (GRCm39) H1786Q Het
Wwox A G 8: 115,215,682 (GRCm39) I152V probably benign Het
Ythdc2 A G 18: 44,977,418 (GRCm39) T405A probably benign Het
Zfpm2 A T 15: 40,962,712 (GRCm39) I257F possibly damaging Het
Other mutations in Or5b118
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03256:Or5b118 APN 19 13,448,631 (GRCm39) missense probably damaging 0.99
D605:Or5b118 UTSW 19 13,448,521 (GRCm39) nonsense probably null
R0173:Or5b118 UTSW 19 13,449,065 (GRCm39) missense probably benign 0.02
R1102:Or5b118 UTSW 19 13,448,771 (GRCm39) missense probably damaging 0.97
R1515:Or5b118 UTSW 19 13,449,044 (GRCm39) missense probably damaging 0.97
R1780:Or5b118 UTSW 19 13,448,726 (GRCm39) missense probably benign 0.14
R2061:Or5b118 UTSW 19 13,448,605 (GRCm39) missense probably damaging 0.98
R4016:Or5b118 UTSW 19 13,448,561 (GRCm39) missense possibly damaging 0.95
R4485:Or5b118 UTSW 19 13,448,919 (GRCm39) missense probably benign 0.08
R5119:Or5b118 UTSW 19 13,448,910 (GRCm39) missense probably benign 0.00
R5150:Or5b118 UTSW 19 13,448,794 (GRCm39) missense probably benign 0.01
R5156:Or5b118 UTSW 19 13,449,037 (GRCm39) missense probably damaging 1.00
R5699:Or5b118 UTSW 19 13,448,336 (GRCm39) start codon destroyed probably null 0.78
R5800:Or5b118 UTSW 19 13,449,260 (GRCm39) missense probably benign 0.06
R5840:Or5b118 UTSW 19 13,449,242 (GRCm39) missense probably benign 0.01
R5953:Or5b118 UTSW 19 13,448,732 (GRCm39) missense possibly damaging 0.92
R5997:Or5b118 UTSW 19 13,448,870 (GRCm39) missense probably benign 0.12
R6233:Or5b118 UTSW 19 13,449,104 (GRCm39) missense probably damaging 1.00
R6488:Or5b118 UTSW 19 13,448,981 (GRCm39) missense probably damaging 1.00
R6847:Or5b118 UTSW 19 13,448,402 (GRCm39) missense probably benign 0.03
R6964:Or5b118 UTSW 19 13,448,725 (GRCm39) nonsense probably null
R7214:Or5b118 UTSW 19 13,448,337 (GRCm39) start codon destroyed probably null 1.00
R8001:Or5b118 UTSW 19 13,448,786 (GRCm39) missense probably benign 0.03
R8035:Or5b118 UTSW 19 13,449,263 (GRCm39) missense probably benign
R8129:Or5b118 UTSW 19 13,448,508 (GRCm39) missense probably damaging 1.00
R9018:Or5b118 UTSW 19 13,448,721 (GRCm39) missense possibly damaging 0.60
R9061:Or5b118 UTSW 19 13,448,523 (GRCm39) missense probably damaging 0.98
R9373:Or5b118 UTSW 19 13,449,216 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATACTGATTCTGCTGGACTCCC -3'
(R):5'- TGTGTGGGTGTCAGAACAAG -3'

Sequencing Primer
(F):5'- GATTCTGCTGGACTCCCGACTC -3'
(R):5'- TCTAGCAGTGGGGGAATGTCAC -3'
Posted On 2021-11-19