Incidental Mutation 'R9066:Atp1a1'
ID 689252
Institutional Source Beutler Lab
Gene Symbol Atp1a1
Ensembl Gene ENSMUSG00000033161
Gene Name ATPase, Na+/K+ transporting, alpha 1 polypeptide
Synonyms Atpa-1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9066 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 101576219-101604684 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 101582022 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 758 (I758T)
Ref Sequence ENSEMBL: ENSMUSP00000039657 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036493]
AlphaFold Q8VDN2
Predicted Effect probably damaging
Transcript: ENSMUST00000036493
AA Change: I758T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039657
Gene: ENSMUSG00000033161
AA Change: I758T

DomainStartEndE-ValueType
low complexity region 21 28 N/A INTRINSIC
Cation_ATPase_N 42 116 5e-20 SMART
Pfam:E1-E2_ATPase 134 365 1.6e-59 PFAM
Pfam:Hydrolase 370 729 2.7e-19 PFAM
Pfam:HAD 373 726 1.3e-18 PFAM
Pfam:Cation_ATPase 426 521 2.2e-25 PFAM
Pfam:Cation_ATPase_C 799 1008 1.2e-46 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 96% (46/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of Na+/K+ -ATPases. Na+/K+ -ATPase is an integral membrane protein responsible for establishing and maintaining the electrochemical gradients of Na and K ions across the plasma membrane. These gradients are essential for osmoregulation, for sodium-coupled transport of a variety of organic and inorganic molecules, and for electrical excitability of nerve and muscle. This enzyme is composed of two subunits, a large catalytic subunit (alpha) and a smaller glycoprotein subunit (beta). The catalytic subunit of Na+/K+ -ATPase is encoded by multiple genes. This gene encodes an alpha 1 subunit. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]
PHENOTYPE: Mice homozygous for disruptions in this gene have a lethal phenotype. Heterozygotes display increased anxiety and decreased exploratory behavior in a new environment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210010C04Rik C T 6: 41,031,706 G225R probably benign Het
Abca7 A G 10: 80,013,354 T1858A probably damaging Het
Atp2c1 T C 9: 105,453,646 E225G probably damaging Het
Clec7a A C 6: 129,467,528 S115A probably benign Het
Cnbd1 T C 4: 19,098,181 T80A probably benign Het
Ctu1 A G 7: 43,676,595 H226R possibly damaging Het
Dctn4 T C 18: 60,526,315 F29L probably damaging Het
Dnajb2 A G 1: 75,241,230 T169A Het
Esf1 A T 2: 140,148,773 M597K probably benign Het
Fam71e2 T C 7: 4,770,519 probably benign Het
Fzd7 C T 1: 59,482,832 probably benign Het
Gapvd1 C A 2: 34,727,285 Q349H probably damaging Het
Gata5 A G 2: 180,326,968 F371S Het
Gm11639 T A 11: 104,740,862 probably benign Het
Gm572 A T 4: 148,666,821 Q217L possibly damaging Het
Igkv14-130 T A 6: 67,791,235 M26K probably damaging Het
Jchain T G 5: 88,527,779 M1L probably benign Het
Kcnj14 G A 7: 45,819,649 T144M probably damaging Het
Kirrel2 C A 7: 30,454,029 A302S probably damaging Het
Klhl29 C T 12: 5,210,114 V35I probably benign Het
Kndc1 C T 7: 139,927,795 S1222F possibly damaging Het
Lgi4 A C 7: 31,060,021 M1L probably benign Het
Ncr1 A G 7: 4,344,553 D276G probably benign Het
Nfatc3 T A 8: 106,099,150 M619K probably benign Het
Nudcd1 A T 15: 44,380,192 F441I probably damaging Het
Nxt2 C T X: 142,237,751 A118V possibly damaging Het
Olfr519 A T 7: 108,894,046 Y125* probably null Het
Olfr874 T G 9: 37,746,575 V147G possibly damaging Het
Pop1 A T 15: 34,515,914 Q586L possibly damaging Het
Rcbtb1 T G 14: 59,224,757 I279S possibly damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,911 probably benign Het
Serpine3 A G 14: 62,692,106 D401G probably damaging Het
Slc25a4 A G 8: 46,209,078 V181A probably damaging Het
Slc26a2 T G 18: 61,202,058 I108L probably benign Het
Slc27a5 A C 7: 12,988,603 V648G possibly damaging Het
Slc2a7 T C 4: 150,166,415 F431S probably damaging Het
Sox11 T C 12: 27,341,423 H329R possibly damaging Het
Speg G A 1: 75,385,010 G223R probably damaging Het
Synpo2 G A 3: 123,117,484 H171Y possibly damaging Het
Tle6 G T 10: 81,594,378 N323K possibly damaging Het
Ugt3a2 A T 15: 9,367,298 M376L possibly damaging Het
Unc13d T C 11: 116,066,735 K798R probably benign Het
Vasp A T 7: 19,264,508 H80Q probably damaging Het
Vmn2r28 T C 7: 5,488,597 D217G probably damaging Het
Vps41 T C 13: 18,823,848 S284P probably damaging Het
Zer1 A C 2: 30,110,674 L245R probably damaging Het
Zfp516 G T 18: 82,955,839 R54L probably damaging Het
Zfp868 T C 8: 69,611,641 K348E probably damaging Het
Other mutations in Atp1a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01396:Atp1a1 APN 3 101591453 missense probably damaging 1.00
IGL01700:Atp1a1 APN 3 101594258 missense possibly damaging 0.95
IGL01836:Atp1a1 APN 3 101591414 missense probably damaging 1.00
IGL01863:Atp1a1 APN 3 101591889 nonsense probably null
IGL02021:Atp1a1 APN 3 101594208 missense probably benign 0.02
IGL02078:Atp1a1 APN 3 101591863 missense probably damaging 1.00
IGL02873:Atp1a1 APN 3 101576578 missense probably benign 0.16
IGL02934:Atp1a1 APN 3 101576992 nonsense probably null
IGL03068:Atp1a1 APN 3 101583859 missense probably benign 0.26
PIT4453001:Atp1a1 UTSW 3 101581179 missense probably benign 0.01
R0009:Atp1a1 UTSW 3 101579835 missense possibly damaging 0.67
R0506:Atp1a1 UTSW 3 101589812 missense probably damaging 0.96
R0724:Atp1a1 UTSW 3 101592439 missense possibly damaging 0.50
R0826:Atp1a1 UTSW 3 101584853 missense probably damaging 0.99
R1457:Atp1a1 UTSW 3 101590466 missense probably damaging 1.00
R1732:Atp1a1 UTSW 3 101584799 missense probably damaging 1.00
R1843:Atp1a1 UTSW 3 101582017 missense probably benign 0.43
R2172:Atp1a1 UTSW 3 101590548 missense probably benign
R3770:Atp1a1 UTSW 3 101581194 missense probably benign 0.17
R3905:Atp1a1 UTSW 3 101590612 missense probably benign 0.00
R4602:Atp1a1 UTSW 3 101586943 missense probably benign 0.00
R4611:Atp1a1 UTSW 3 101586943 missense probably benign 0.00
R4715:Atp1a1 UTSW 3 101591806 missense possibly damaging 0.90
R4777:Atp1a1 UTSW 3 101594996 critical splice donor site probably null
R4795:Atp1a1 UTSW 3 101583775 missense probably benign 0.15
R5030:Atp1a1 UTSW 3 101579817 missense probably benign 0.22
R5066:Atp1a1 UTSW 3 101582104 missense probably damaging 0.98
R5165:Atp1a1 UTSW 3 101581789 missense probably benign 0.01
R5297:Atp1a1 UTSW 3 101591127 missense possibly damaging 0.82
R5307:Atp1a1 UTSW 3 101589964 missense probably damaging 1.00
R5379:Atp1a1 UTSW 3 101582095 missense probably benign 0.01
R5495:Atp1a1 UTSW 3 101591425 missense probably benign 0.01
R5946:Atp1a1 UTSW 3 101589774 missense probably benign 0.12
R6125:Atp1a1 UTSW 3 101590707 missense probably damaging 1.00
R6789:Atp1a1 UTSW 3 101586298 missense possibly damaging 0.71
R7339:Atp1a1 UTSW 3 101589872 missense probably benign 0.44
R7552:Atp1a1 UTSW 3 101582121 nonsense probably null
R7825:Atp1a1 UTSW 3 101586169 missense probably benign 0.00
R8098:Atp1a1 UTSW 3 101582049 missense probably damaging 0.97
R8175:Atp1a1 UTSW 3 101584854 missense possibly damaging 0.79
R8281:Atp1a1 UTSW 3 101579624 missense probably benign 0.12
R8403:Atp1a1 UTSW 3 101586904 missense probably damaging 1.00
R8435:Atp1a1 UTSW 3 101582762 missense probably benign
R8461:Atp1a1 UTSW 3 101589089 missense probably benign 0.01
R8772:Atp1a1 UTSW 3 101579808 missense probably benign
R8782:Atp1a1 UTSW 3 101594217 missense possibly damaging 0.63
R8919:Atp1a1 UTSW 3 101591231 missense probably damaging 1.00
R9227:Atp1a1 UTSW 3 101592434 missense probably damaging 1.00
X0019:Atp1a1 UTSW 3 101594213 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGCAGAGGATGGTCACAGTC -3'
(R):5'- CATCCCTGCAAAGATTTGGGC -3'

Sequencing Primer
(F):5'- TATCAAGAAGGGGGTGATTTCC -3'
(R):5'- CAAAGATTTGGGCTTTATTAACCCCC -3'
Posted On 2021-11-19