Incidental Mutation 'R9066:Pop1'
ID 689286
Institutional Source Beutler Lab
Gene Symbol Pop1
Ensembl Gene ENSMUSG00000022325
Gene Name processing of precursor 1, ribonuclease P/MRP family, (S. cerevisiae)
Synonyms 4932434G09Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.960) question?
Stock # R9066 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 34495304-34530648 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 34515914 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Leucine at position 586 (Q586L)
Ref Sequence ENSEMBL: ENSMUSP00000052654 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052290] [ENSMUST00000079028]
AlphaFold Q8K205
Predicted Effect possibly damaging
Transcript: ENSMUST00000052290
AA Change: Q586L

PolyPhen 2 Score 0.679 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000052654
Gene: ENSMUSG00000022325
AA Change: Q586L

DomainStartEndE-ValueType
Pfam:POP1 107 190 6.2e-21 PFAM
Pfam:POP1 179 257 2.5e-23 PFAM
low complexity region 382 387 N/A INTRINSIC
Pfam:POPLD 647 738 1.4e-30 PFAM
low complexity region 931 940 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000079028
AA Change: Q556L

PolyPhen 2 Score 0.679 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000078037
Gene: ENSMUSG00000022325
AA Change: Q556L

DomainStartEndE-ValueType
Pfam:POP1 107 258 1e-46 PFAM
low complexity region 382 387 N/A INTRINSIC
Pfam:POPLD 617 708 1.2e-34 PFAM
low complexity region 901 910 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the protein subunit of two different small nucleolar ribonucleoprotein complexes: the endoribonuclease for mitochondrial RNA processing complex and the ribonuclease P complex. The encoded protein is a ribonuclease that localizes to the nucleus and functions in pre-RNA processing. This protein is also an autoantigen in patients suffering from connective tissue diseases. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2009]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210010C04Rik C T 6: 41,031,706 G225R probably benign Het
Abca7 A G 10: 80,013,354 T1858A probably damaging Het
Atp1a1 A G 3: 101,582,022 I758T probably damaging Het
Atp2c1 T C 9: 105,453,646 E225G probably damaging Het
Clec7a A C 6: 129,467,528 S115A probably benign Het
Cnbd1 T C 4: 19,098,181 T80A probably benign Het
Ctu1 A G 7: 43,676,595 H226R possibly damaging Het
Dctn4 T C 18: 60,526,315 F29L probably damaging Het
Dnajb2 A G 1: 75,241,230 T169A Het
Esf1 A T 2: 140,148,773 M597K probably benign Het
Fzd7 C T 1: 59,482,832 probably benign Het
Gapvd1 C A 2: 34,727,285 Q349H probably damaging Het
Gata5 A G 2: 180,326,968 F371S Het
Gm572 A T 4: 148,666,821 Q217L possibly damaging Het
Igkv14-130 T A 6: 67,791,235 M26K probably damaging Het
Jchain T G 5: 88,527,779 M1L probably benign Het
Kcnj14 G A 7: 45,819,649 T144M probably damaging Het
Kirrel2 C A 7: 30,454,029 A302S probably damaging Het
Klhl29 C T 12: 5,210,114 V35I probably benign Het
Kndc1 C T 7: 139,927,795 S1222F possibly damaging Het
Lgi4 A C 7: 31,060,021 M1L probably benign Het
Ncr1 A G 7: 4,344,553 D276G probably benign Het
Nfatc3 T A 8: 106,099,150 M619K probably benign Het
Nudcd1 A T 15: 44,380,192 F441I probably damaging Het
Nxt2 C T X: 142,237,751 A118V possibly damaging Het
Olfr519 A T 7: 108,894,046 Y125* probably null Het
Olfr874 T G 9: 37,746,575 V147G possibly damaging Het
Rcbtb1 T G 14: 59,224,757 I279S possibly damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,911 probably benign Het
Serpine3 A G 14: 62,692,106 D401G probably damaging Het
Slc25a4 A G 8: 46,209,078 V181A probably damaging Het
Slc26a2 T G 18: 61,202,058 I108L probably benign Het
Slc27a5 A C 7: 12,988,603 V648G possibly damaging Het
Slc2a7 T C 4: 150,166,415 F431S probably damaging Het
Sox11 T C 12: 27,341,423 H329R possibly damaging Het
Speg G A 1: 75,385,010 G223R probably damaging Het
Synpo2 G A 3: 123,117,484 H171Y possibly damaging Het
Tle6 G T 10: 81,594,378 N323K possibly damaging Het
Ugt3a2 A T 15: 9,367,298 M376L possibly damaging Het
Unc13d T C 11: 116,066,735 K798R probably benign Het
Vasp A T 7: 19,264,508 H80Q probably damaging Het
Vmn2r28 T C 7: 5,488,597 D217G probably damaging Het
Vps41 T C 13: 18,823,848 S284P probably damaging Het
Zer1 A C 2: 30,110,674 L245R probably damaging Het
Zfp516 G T 18: 82,955,839 R54L probably damaging Het
Zfp868 T C 8: 69,611,641 K348E probably damaging Het
Other mutations in Pop1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Pop1 APN 15 34508729 missense probably benign 0.00
IGL02192:Pop1 APN 15 34529071 missense probably benign 0.08
IGL02680:Pop1 APN 15 34502473 missense probably damaging 0.99
IGL02958:Pop1 APN 15 34530363 missense probably damaging 0.99
H8562:Pop1 UTSW 15 34530212 missense probably benign 0.00
PIT4802001:Pop1 UTSW 15 34529083 missense probably benign 0.00
R0244:Pop1 UTSW 15 34515891 nonsense probably null
R0281:Pop1 UTSW 15 34529858 splice site probably null
R0453:Pop1 UTSW 15 34526206 missense possibly damaging 0.82
R0579:Pop1 UTSW 15 34509969 missense possibly damaging 0.68
R1054:Pop1 UTSW 15 34509809 missense probably benign 0.30
R1501:Pop1 UTSW 15 34510357 missense probably benign 0.01
R1614:Pop1 UTSW 15 34530210 missense possibly damaging 0.46
R1994:Pop1 UTSW 15 34530471 missense probably damaging 1.00
R2084:Pop1 UTSW 15 34508598 splice site probably benign
R4020:Pop1 UTSW 15 34508780 missense probably benign 0.01
R4550:Pop1 UTSW 15 34528936 missense probably damaging 1.00
R4579:Pop1 UTSW 15 34515824 intron probably benign
R5672:Pop1 UTSW 15 34530179 missense possibly damaging 0.63
R6139:Pop1 UTSW 15 34529058 missense probably benign 0.26
R6161:Pop1 UTSW 15 34526310 missense probably damaging 1.00
R6821:Pop1 UTSW 15 34508639 missense possibly damaging 0.86
R7053:Pop1 UTSW 15 34530275 missense probably benign 0.01
R7195:Pop1 UTSW 15 34510379 missense probably damaging 0.97
R7543:Pop1 UTSW 15 34530447 missense probably damaging 1.00
R7571:Pop1 UTSW 15 34528947 missense probably null 1.00
R7587:Pop1 UTSW 15 34502413 missense probably damaging 0.97
R8401:Pop1 UTSW 15 34508609 missense probably damaging 1.00
R8406:Pop1 UTSW 15 34529170 missense probably benign
R8707:Pop1 UTSW 15 34529203 missense probably benign 0.02
R9044:Pop1 UTSW 15 34530408 missense possibly damaging 0.94
R9236:Pop1 UTSW 15 34499412 missense probably damaging 0.98
RF001:Pop1 UTSW 15 34502437 missense probably damaging 1.00
RF002:Pop1 UTSW 15 34502437 missense probably damaging 1.00
Z1088:Pop1 UTSW 15 34499319 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCTGTTGACTGCGTGAAG -3'
(R):5'- GGGCCCAATCATTGTGAACTTAC -3'

Sequencing Primer
(F):5'- GCCCTTTGCTGTCTTCGG -3'
(R):5'- ACTCCAGTGACTCCCATA -3'
Posted On 2021-11-19