Incidental Mutation 'R9067:Pld5'
ID 689294
Institutional Source Beutler Lab
Gene Symbol Pld5
Ensembl Gene ENSMUSG00000055214
Gene Name phospholipase D family, member 5
Synonyms B230365F16Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9067 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 175962306-176275312 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 176089908 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 153 (H153L)
Ref Sequence ENSEMBL: ENSMUSP00000069326 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065967] [ENSMUST00000111167] [ENSMUST00000125404]
AlphaFold Q3UNN8
Predicted Effect probably benign
Transcript: ENSMUST00000065967
AA Change: H153L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000069326
Gene: ENSMUSG00000055214
AA Change: H153L

DomainStartEndE-ValueType
transmembrane domain 68 90 N/A INTRINSIC
PLDc 215 242 3.62e-3 SMART
Pfam:PLDc_3 245 421 2e-101 PFAM
PLDc 434 460 6.11e0 SMART
low complexity region 511 521 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111167
AA Change: H91L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000106797
Gene: ENSMUSG00000055214
AA Change: H91L

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
PLDc 153 180 3.62e-3 SMART
PLDc 372 398 6.11e0 SMART
low complexity region 449 459 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125404
SMART Domains Protein: ENSMUSP00000121428
Gene: ENSMUSG00000055214

DomainStartEndE-ValueType
transmembrane domain 69 91 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: No abnormal phenotype was observed in a high-throughput screen, nor in a pathology assessment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik T G 2: 19,517,682 D202A probably damaging Het
Aass T A 6: 23,077,124 R745S probably benign Het
Adamts14 C T 10: 61,249,660 R195H possibly damaging Het
Afm T C 5: 90,523,815 F119L probably benign Het
Alox5ap T A 5: 149,285,380 V93E probably damaging Het
Ascl3 G A 7: 109,727,897 P72S probably benign Het
Cacnb1 C A 11: 98,005,305 D386Y probably damaging Het
Cep350 T C 1: 155,861,739 E2786G probably benign Het
Chd1 A T 17: 15,730,845 K227N possibly damaging Het
Cyp4f13 C G 17: 32,924,827 E508Q probably damaging Het
Dlgap1 T A 17: 70,809,191 L843Q probably damaging Het
Elk4 T G 1: 132,014,405 I5S possibly damaging Het
Erc1 A T 6: 119,797,075 D306E possibly damaging Het
Fars2 G A 13: 36,204,863 V112I probably benign Het
Gdf2 A T 14: 33,941,454 T102S probably benign Het
Glb1 A G 9: 114,473,854 N586S probably damaging Het
Gm340 C T 19: 41,585,259 R818W probably damaging Het
Gm45861 T A 8: 27,505,015 S472T unknown Het
Gm5800 G A 14: 51,714,538 A89V possibly damaging Het
Gm6583 T G 5: 112,354,840 I333L possibly damaging Het
Gpalpp1 A G 14: 76,107,352 S64P probably damaging Het
Hbq1a T C 11: 32,300,400 V63A probably damaging Het
Htr7 A G 19: 36,057,090 V55A probably benign Het
Ica1 T A 6: 8,667,362 D268V probably benign Het
Ipo8 T C 6: 148,777,232 E956G probably damaging Het
Jarid2 G T 13: 44,840,850 V13L Het
Kdr T C 5: 75,948,768 D983G probably damaging Het
Klhl23 C G 2: 69,833,739 I477M possibly damaging Het
Kpna2 G T 11: 106,991,213 H262Q possibly damaging Het
Lrrc17 G A 5: 21,561,035 E172K probably benign Het
Lrrc45 A T 11: 120,715,823 I184F possibly damaging Het
Med11 A G 11: 70,452,084 T36A probably benign Het
Mtf2 A G 5: 108,104,267 D423G probably benign Het
Ndfip2 A G 14: 105,287,723 D146G probably benign Het
Nfat5 A G 8: 107,367,904 I926V probably benign Het
Paqr6 T A 3: 88,366,021 S107T probably damaging Het
Pdgfrb G A 18: 61,068,219 S459N probably null Het
Pmfbp1 A G 8: 109,536,612 R788G possibly damaging Het
Smok2a A C 17: 13,226,938 R467S probably damaging Het
Sncaip A C 18: 52,906,901 K722N probably damaging Het
Ssfa2 G A 2: 79,644,836 E380K probably benign Het
Sycp2 A G 2: 178,347,421 probably null Het
Syne2 T A 12: 75,904,220 W382R probably damaging Het
Tiam2 T C 17: 3,511,132 V1324A probably damaging Het
Tmem120b A T 5: 123,098,244 I47F probably damaging Het
Tubg2 G A 11: 101,159,131 C201Y probably damaging Het
Umodl1 A G 17: 30,973,703 E268G probably damaging Het
Zfyve26 T G 12: 79,272,141 D1141A probably damaging Het
Other mutations in Pld5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00815:Pld5 APN 1 176140019 missense probably damaging 1.00
IGL00949:Pld5 APN 1 175975473 missense probably damaging 1.00
IGL01067:Pld5 APN 1 176274879 utr 5 prime probably benign
IGL02174:Pld5 APN 1 176274744 missense possibly damaging 0.86
IGL02380:Pld5 APN 1 176140044 missense probably damaging 0.97
IGL02879:Pld5 APN 1 175970591 missense probably damaging 1.00
R0087:Pld5 UTSW 1 175984459 missense probably damaging 0.98
R0135:Pld5 UTSW 1 175970589 missense probably damaging 1.00
R0144:Pld5 UTSW 1 175970541 missense probably benign 0.00
R0362:Pld5 UTSW 1 175975580 nonsense probably null
R0453:Pld5 UTSW 1 176089956 missense possibly damaging 0.75
R0454:Pld5 UTSW 1 176274729 missense probably benign 0.00
R0722:Pld5 UTSW 1 175975515 missense probably benign 0.34
R0751:Pld5 UTSW 1 176044896 missense probably damaging 0.98
R0785:Pld5 UTSW 1 175975452 splice site probably benign
R1184:Pld5 UTSW 1 176044896 missense probably damaging 0.98
R1501:Pld5 UTSW 1 175975521 missense probably benign 0.36
R1644:Pld5 UTSW 1 175975626 missense possibly damaging 0.86
R2012:Pld5 UTSW 1 175964013 missense probably benign 0.27
R2426:Pld5 UTSW 1 175963976 missense probably benign
R3508:Pld5 UTSW 1 175994037 missense probably damaging 1.00
R3917:Pld5 UTSW 1 175963938 missense probably benign 0.00
R4207:Pld5 UTSW 1 175993875 missense probably damaging 1.00
R4373:Pld5 UTSW 1 176140017 missense probably damaging 1.00
R4828:Pld5 UTSW 1 176274867 missense probably benign 0.06
R4831:Pld5 UTSW 1 176274884 utr 5 prime probably benign
R5861:Pld5 UTSW 1 176090005 missense probably damaging 1.00
R6182:Pld5 UTSW 1 176044854 missense probably benign 0.35
R6191:Pld5 UTSW 1 175970534 missense probably benign 0.04
R6246:Pld5 UTSW 1 175963909 nonsense probably null
R6737:Pld5 UTSW 1 176090022 missense probably damaging 1.00
R7082:Pld5 UTSW 1 176089876 missense probably benign 0.21
R7164:Pld5 UTSW 1 176213621 start codon destroyed probably null 0.00
R7237:Pld5 UTSW 1 176274735 missense possibly damaging 0.79
R7635:Pld5 UTSW 1 175993850 critical splice donor site probably null
R7805:Pld5 UTSW 1 176044914 missense probably damaging 1.00
R7967:Pld5 UTSW 1 176274698 missense probably benign 0.03
R8038:Pld5 UTSW 1 176044897 missense probably benign 0.19
R8995:Pld5 UTSW 1 175964014 missense probably benign 0.01
R9033:Pld5 UTSW 1 176140019 missense probably damaging 0.99
R9156:Pld5 UTSW 1 175975538 missense possibly damaging 0.73
R9156:Pld5 UTSW 1 176074437 missense probably benign 0.05
X0004:Pld5 UTSW 1 176261522 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- AACACAGAACTCTTGTGCTCTTG -3'
(R):5'- TTCTCTGAATGCAGGTGATAAGATC -3'

Sequencing Primer
(F):5'- AACTCTTGTGCTCTTGGGGGAG -3'
(R):5'- GCAGGTGATAAGATCAATAGCTTC -3'
Posted On 2021-11-19