Incidental Mutation 'R9067:Gdf2'
ID 689327
Institutional Source Beutler Lab
Gene Symbol Gdf2
Ensembl Gene ENSMUSG00000072625
Gene Name growth differentiation factor 2
Synonyms Bmp9
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9067 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 33941039-33947198 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 33941454 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 102 (T102S)
Ref Sequence ENSEMBL: ENSMUSP00000098286 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100720] [ENSMUST00000168727]
AlphaFold Q9WV56
PDB Structure Pro-bone morphogenetic protein 9 [X-RAY DIFFRACTION]
non-latent pro-bone morphogenetic protein 9 [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000100720
AA Change: T102S

PolyPhen 2 Score 0.205 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000098286
Gene: ENSMUSG00000072625
AA Change: T102S

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 39 50 N/A INTRINSIC
Pfam:TGFb_propeptide 55 256 8.5e-21 PFAM
TGFB 326 428 3.83e-56 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168727
SMART Domains Protein: ENSMUSP00000128621
Gene: ENSMUSG00000021943

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
low complexity region 56 67 N/A INTRINSIC
TGFB 374 476 1e-50 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. This protein regulates cartilage and bone development, angiogenesis and differentiation of cholinergic central nervous system neurons. Homozygous null mice exhibit malformations of the vasculature and skeleton. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygotes for a null allele show arteriovenous malformations, skeletal anomalies, and abnormal retinal vasculature after anti-BMP10-antibody treatment. Homozygotes for a different null allele show abnormal retinal and tracheal vasculature and tracheal lymphatic vessels after anti-BMP10 treatment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik T G 2: 19,517,682 D202A probably damaging Het
Aass T A 6: 23,077,124 R745S probably benign Het
Adamts14 C T 10: 61,249,660 R195H possibly damaging Het
Afm T C 5: 90,523,815 F119L probably benign Het
Alox5ap T A 5: 149,285,380 V93E probably damaging Het
Ascl3 G A 7: 109,727,897 P72S probably benign Het
Cacnb1 C A 11: 98,005,305 D386Y probably damaging Het
Cep350 T C 1: 155,861,739 E2786G probably benign Het
Chd1 A T 17: 15,730,845 K227N possibly damaging Het
Cyp4f13 C G 17: 32,924,827 E508Q probably damaging Het
Dlgap1 T A 17: 70,809,191 L843Q probably damaging Het
Elk4 T G 1: 132,014,405 I5S possibly damaging Het
Erc1 A T 6: 119,797,075 D306E possibly damaging Het
Fars2 G A 13: 36,204,863 V112I probably benign Het
Glb1 A G 9: 114,473,854 N586S probably damaging Het
Gm340 C T 19: 41,585,259 R818W probably damaging Het
Gm45861 T A 8: 27,505,015 S472T unknown Het
Gm5800 G A 14: 51,714,538 A89V possibly damaging Het
Gm6583 T G 5: 112,354,840 I333L possibly damaging Het
Gpalpp1 A G 14: 76,107,352 S64P probably damaging Het
Hbq1a T C 11: 32,300,400 V63A probably damaging Het
Htr7 A G 19: 36,057,090 V55A probably benign Het
Ica1 T A 6: 8,667,362 D268V probably benign Het
Ipo8 T C 6: 148,777,232 E956G probably damaging Het
Jarid2 G T 13: 44,840,850 V13L Het
Kdr T C 5: 75,948,768 D983G probably damaging Het
Klhl23 C G 2: 69,833,739 I477M possibly damaging Het
Kpna2 G T 11: 106,991,213 H262Q possibly damaging Het
Lrrc17 G A 5: 21,561,035 E172K probably benign Het
Lrrc45 A T 11: 120,715,823 I184F possibly damaging Het
Med11 A G 11: 70,452,084 T36A probably benign Het
Mtf2 A G 5: 108,104,267 D423G probably benign Het
Ndfip2 A G 14: 105,287,723 D146G probably benign Het
Nfat5 A G 8: 107,367,904 I926V probably benign Het
Paqr6 T A 3: 88,366,021 S107T probably damaging Het
Pdgfrb G A 18: 61,068,219 S459N probably null Het
Pld5 T A 1: 176,089,908 H153L probably benign Het
Pmfbp1 A G 8: 109,536,612 R788G possibly damaging Het
Smok2a A C 17: 13,226,938 R467S probably damaging Het
Sncaip A C 18: 52,906,901 K722N probably damaging Het
Ssfa2 G A 2: 79,644,836 E380K probably benign Het
Sycp2 A G 2: 178,347,421 probably null Het
Syne2 T A 12: 75,904,220 W382R probably damaging Het
Tiam2 T C 17: 3,511,132 V1324A probably damaging Het
Tmem120b A T 5: 123,098,244 I47F probably damaging Het
Tubg2 G A 11: 101,159,131 C201Y probably damaging Het
Umodl1 A G 17: 30,973,703 E268G probably damaging Het
Zfyve26 T G 12: 79,272,141 D1141A probably damaging Het
Other mutations in Gdf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0557:Gdf2 UTSW 14 33941221 missense probably damaging 1.00
R0631:Gdf2 UTSW 14 33941221 missense probably damaging 1.00
R0739:Gdf2 UTSW 14 33941221 missense probably damaging 1.00
R2142:Gdf2 UTSW 14 33945241 missense probably benign
R2292:Gdf2 UTSW 14 33945188 missense possibly damaging 0.60
R3615:Gdf2 UTSW 14 33944957 missense probably damaging 1.00
R3616:Gdf2 UTSW 14 33944957 missense probably damaging 1.00
R3974:Gdf2 UTSW 14 33944834 missense probably damaging 0.97
R3975:Gdf2 UTSW 14 33944834 missense probably damaging 0.97
R3976:Gdf2 UTSW 14 33944834 missense probably damaging 0.97
R4665:Gdf2 UTSW 14 33945451 missense probably damaging 1.00
R5007:Gdf2 UTSW 14 33944906 missense probably benign 0.02
R5227:Gdf2 UTSW 14 33941494 critical splice donor site probably null
R5253:Gdf2 UTSW 14 33945307 missense probably benign 0.14
R5259:Gdf2 UTSW 14 33944831 missense probably benign 0.01
R6286:Gdf2 UTSW 14 33945100 missense probably damaging 1.00
R7644:Gdf2 UTSW 14 33944890 missense probably benign 0.00
R8472:Gdf2 UTSW 14 33944840 missense probably damaging 1.00
Z1177:Gdf2 UTSW 14 33945317 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CTGCAGAACTGGGAACAAGC -3'
(R):5'- ATTGGGAGTCACTTCCACAG -3'

Sequencing Primer
(F):5'- ACAGCTCCCTGGGATTGTCTG -3'
(R):5'- TTGGGAGTCACTTCCACAGAAACC -3'
Posted On 2021-11-19