Incidental Mutation 'R9068:Syt6'
ID 689352
Institutional Source Beutler Lab
Gene Symbol Syt6
Ensembl Gene ENSMUSG00000027849
Gene Name synaptotagmin VI
Synonyms 3110037A08Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock # R9068 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 103575231-103645569 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) C to A at 103587509 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Stop codon at position 263 (C263*)
Ref Sequence ENSEMBL: ENSMUSP00000112997 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090697] [ENSMUST00000117221] [ENSMUST00000118117] [ENSMUST00000118563] [ENSMUST00000121834] [ENSMUST00000132325] [ENSMUST00000136049] [ENSMUST00000151985] [ENSMUST00000183637]
AlphaFold Q9R0N8
Predicted Effect probably null
Transcript: ENSMUST00000090697
AA Change: C263*
SMART Domains Protein: ENSMUSP00000088196
Gene: ENSMUSG00000027849
AA Change: C263*

DomainStartEndE-ValueType
transmembrane domain 59 81 N/A INTRINSIC
low complexity region 93 103 N/A INTRINSIC
C2 246 350 2.65e-20 SMART
C2 378 492 2.25e-23 SMART
Predicted Effect probably null
Transcript: ENSMUST00000117221
AA Change: C178*
SMART Domains Protein: ENSMUSP00000113373
Gene: ENSMUSG00000027849
AA Change: C178*

DomainStartEndE-ValueType
low complexity region 8 18 N/A INTRINSIC
C2 161 265 2.65e-20 SMART
C2 293 407 2.25e-23 SMART
Predicted Effect probably null
Transcript: ENSMUST00000118117
AA Change: C178*
SMART Domains Protein: ENSMUSP00000112486
Gene: ENSMUSG00000027849
AA Change: C178*

DomainStartEndE-ValueType
low complexity region 8 18 N/A INTRINSIC
C2 161 265 2.65e-20 SMART
C2 293 407 2.25e-23 SMART
Predicted Effect probably null
Transcript: ENSMUST00000118563
AA Change: C178*
SMART Domains Protein: ENSMUSP00000113287
Gene: ENSMUSG00000027849
AA Change: C178*

DomainStartEndE-ValueType
low complexity region 8 18 N/A INTRINSIC
C2 161 265 2.65e-20 SMART
Pfam:C2 294 332 3.5e-2 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000121834
AA Change: C263*
SMART Domains Protein: ENSMUSP00000112997
Gene: ENSMUSG00000027849
AA Change: C263*

DomainStartEndE-ValueType
transmembrane domain 59 81 N/A INTRINSIC
low complexity region 93 103 N/A INTRINSIC
C2 246 350 2.65e-20 SMART
C2 378 492 2.25e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132325
SMART Domains Protein: ENSMUSP00000116324
Gene: ENSMUSG00000027849

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136049
SMART Domains Protein: ENSMUSP00000118124
Gene: ENSMUSG00000027849

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151985
Predicted Effect probably benign
Transcript: ENSMUST00000183637
SMART Domains Protein: ENSMUSP00000138874
Gene: ENSMUSG00000027849

DomainStartEndE-ValueType
low complexity region 8 18 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the synaptotagmin family. Synaptotagmins share a common domain structure that includes a transmembrane domain and a cytoplasmic region composed of 2 C2 domains, and are involved in calcium-dependent exocytosis of synaptic vesicles. This protein has been shown to be a key component of the secretory machinery involved in acrosomal exocytosis. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass T C 6: 23,075,829 I770V probably benign Het
Actr10 T C 12: 70,942,299 L64S probably damaging Het
Adam22 T C 5: 8,127,343 T589A probably benign Het
Akr1b7 T C 6: 34,419,042 S160P probably damaging Het
Ankrd52 C T 10: 128,381,981 H277Y probably damaging Het
Btbd11 C A 10: 85,387,898 N190K unknown Het
Cc2d1b T A 4: 108,624,865 L112Q probably damaging Het
Clec3a A G 8: 114,425,635 D127G probably damaging Het
Cnnm3 T C 1: 36,512,881 L324P probably damaging Het
Cspp1 T C 1: 10,077,244 probably null Het
Cwf19l1 C T 19: 44,135,835 probably benign Het
Cyp26b1 G A 6: 84,574,397 T470I probably damaging Het
Dedd2 A G 7: 25,217,667 V110A probably benign Het
Dnah8 A G 17: 30,756,755 I2866M possibly damaging Het
Dpp10 T C 1: 123,432,938 Y286C probably damaging Het
Efna2 C T 10: 80,188,690 P177L probably damaging Het
Fbxo46 A G 7: 19,135,400 probably benign Het
Gdpd5 A T 7: 99,458,841 T542S probably benign Het
Gm136 T G 4: 34,750,928 D115A possibly damaging Het
Gm7356 T A 17: 14,001,425 K114I possibly damaging Het
Gpr180 G T 14: 118,148,246 E157* probably null Het
Grk4 T C 5: 34,748,309 I466T Het
Hic1 A G 11: 75,169,506 M5T unknown Het
Hmcn2 C A 2: 31,413,673 N3058K probably benign Het
Htr5a T A 5: 27,850,801 H263Q probably benign Het
Lrrc7 T C 3: 158,240,501 K187R probably benign Het
Map3k8 A T 18: 4,340,557 H252Q probably benign Het
Muc4 CAC CACTAC 16: 32,754,076 probably benign Het
Naa16 A T 14: 79,374,849 M233K probably benign Het
Napsa A T 7: 44,585,799 D336V probably damaging Het
Neurod1 T A 2: 79,454,874 N55I possibly damaging Het
Olfr1220 A T 2: 89,097,025 C301S probably benign Het
Olfr1431 T C 19: 12,210,339 F258L probably damaging Het
Olfr874 T A 9: 37,746,667 C178S probably damaging Het
Pcdha8 G T 18: 36,994,270 G602C probably damaging Het
Peg10 T TCCG 6: 4,756,451 probably benign Het
Pigr G A 1: 130,846,494 V404M probably damaging Het
Plch1 G A 3: 63,704,615 P803L probably damaging Het
Ppp4r3b T A 11: 29,209,396 F583L probably benign Het
Rit2 A T 18: 30,975,415 D172E possibly damaging Het
Skint4 C T 4: 112,165,735 P476S possibly damaging Het
Slco2b1 A G 7: 99,670,964 V353A probably benign Het
Slit3 A G 11: 35,684,090 D1077G probably damaging Het
Sun2 A G 15: 79,728,051 F478L probably benign Het
Tfpi C A 2: 84,442,891 L229F unknown Het
Tmem131l A T 3: 83,910,468 C1242S probably benign Het
Ttc3 T A 16: 94,403,360 W280R probably damaging Het
Uncx A G 5: 139,546,818 K213E possibly damaging Het
Usp24 T C 4: 106,375,678 L887P probably benign Het
Vmn1r178 A T 7: 23,893,979 I151F probably damaging Het
Vmn2r50 G T 7: 10,038,134 Q547K possibly damaging Het
Wdfy3 A T 5: 101,852,585 V2973D probably benign Het
Zbtb49 T C 5: 38,200,945 M655V probably benign Het
Zc3h3 C T 15: 75,839,650 A321T probably benign Het
Zeb2 T A 2: 45,110,028 R65W possibly damaging Het
Zfp541 A G 7: 16,078,451 E343G probably damaging Het
Zfp775 C A 6: 48,620,217 R342S probably damaging Het
Zwilch A G 9: 64,168,660 F27L probably benign Het
Other mutations in Syt6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00838:Syt6 APN 3 103625626 missense probably damaging 0.98
IGL02944:Syt6 APN 3 103575549 unclassified probably benign
IGL03168:Syt6 APN 3 103587627 missense probably damaging 1.00
PIT4305001:Syt6 UTSW 3 103575453 missense possibly damaging 0.91
R0124:Syt6 UTSW 3 103587526 missense probably damaging 1.00
R0587:Syt6 UTSW 3 103625571 missense probably damaging 0.99
R0601:Syt6 UTSW 3 103620890 missense probably damaging 1.00
R1262:Syt6 UTSW 3 103585340 critical splice acceptor site probably null
R1970:Syt6 UTSW 3 103587420 missense probably benign 0.21
R4012:Syt6 UTSW 3 103625493 splice site probably benign
R4450:Syt6 UTSW 3 103585645 missense probably benign 0.01
R4493:Syt6 UTSW 3 103585630 missense probably damaging 0.99
R4494:Syt6 UTSW 3 103585630 missense probably damaging 0.99
R4495:Syt6 UTSW 3 103587560 nonsense probably null
R4740:Syt6 UTSW 3 103625656 missense probably damaging 1.00
R4750:Syt6 UTSW 3 103630917 makesense probably null
R5668:Syt6 UTSW 3 103620901 missense probably damaging 1.00
R6185:Syt6 UTSW 3 103585528 missense probably damaging 1.00
R6660:Syt6 UTSW 3 103625644 missense probably damaging 1.00
R7120:Syt6 UTSW 3 103587357 missense probably damaging 1.00
R7307:Syt6 UTSW 3 103587472 missense probably damaging 1.00
R7501:Syt6 UTSW 3 103587702 missense probably benign 0.01
R8768:Syt6 UTSW 3 103585534 missense probably benign
R8867:Syt6 UTSW 3 103627055 missense possibly damaging 0.91
R8885:Syt6 UTSW 3 103625625 missense probably benign 0.06
R9098:Syt6 UTSW 3 103585579 missense probably damaging 0.96
R9361:Syt6 UTSW 3 103575363 unclassified probably benign
Z1177:Syt6 UTSW 3 103645115 missense unknown
Predicted Primers PCR Primer
(F):5'- AGTATTGGCCGTATCAAGCCTG -3'
(R):5'- AGATTGTCCAGGATGACCTCC -3'

Sequencing Primer
(F):5'- AACTTCAGCCTCCGCTAT -3'
(R):5'- CCAATCATGTCATGGCGGGAG -3'
Posted On 2021-11-19