Incidental Mutation 'R9068:Naa16'
ID 689387
Institutional Source Beutler Lab
Gene Symbol Naa16
Ensembl Gene ENSMUSG00000022020
Gene Name N(alpha)-acetyltransferase 16, NatA auxiliary subunit
Synonyms Narg1l, 1300019C06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock # R9068 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 79325269-79390778 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 79374849 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 233 (M233K)
Ref Sequence ENSEMBL: ENSMUSP00000022597 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022597] [ENSMUST00000163486] [ENSMUST00000169500]
AlphaFold Q9DBB4
Predicted Effect probably benign
Transcript: ENSMUST00000022597
AA Change: M233K

PolyPhen 2 Score 0.178 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000022597
Gene: ENSMUSG00000022020
AA Change: M233K

DomainStartEndE-ValueType
TPR 46 79 2.99e1 SMART
TPR 80 113 2.98e-3 SMART
Blast:TPR 224 257 1e-10 BLAST
TPR 374 407 9.96e0 SMART
TPR 408 441 7.47e0 SMART
low complexity region 616 633 N/A INTRINSIC
Blast:TPR 672 705 3e-12 BLAST
low complexity region 830 841 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163486
AA Change: M199K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000131268
Gene: ENSMUSG00000022020
AA Change: M199K

DomainStartEndE-ValueType
TPR 12 45 2.99e1 SMART
TPR 46 79 2.98e-3 SMART
Blast:TPR 190 223 3e-10 BLAST
TPR 340 373 9.96e0 SMART
TPR 374 407 7.47e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169500
SMART Domains Protein: ENSMUSP00000127298
Gene: ENSMUSG00000022020

DomainStartEndE-ValueType
PDB:4KVO|D 1 46 1e-6 PDB
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 97% (57/59)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass T C 6: 23,075,829 I770V probably benign Het
Actr10 T C 12: 70,942,299 L64S probably damaging Het
Adam22 T C 5: 8,127,343 T589A probably benign Het
Akr1b7 T C 6: 34,419,042 S160P probably damaging Het
Ankrd52 C T 10: 128,381,981 H277Y probably damaging Het
Btbd11 C A 10: 85,387,898 N190K unknown Het
Cc2d1b T A 4: 108,624,865 L112Q probably damaging Het
Cd200r3 T A 16: 44,953,387 probably benign Het
Clec3a A G 8: 114,425,635 D127G probably damaging Het
Cnnm3 T C 1: 36,512,881 L324P probably damaging Het
Cspp1 T C 1: 10,077,244 probably null Het
Cwf19l1 C T 19: 44,135,835 probably benign Het
Cyp26b1 G A 6: 84,574,397 T470I probably damaging Het
Dedd2 A G 7: 25,217,667 V110A probably benign Het
Dnah8 A G 17: 30,756,755 I2866M possibly damaging Het
Dpp10 T C 1: 123,432,938 Y286C probably damaging Het
Efna2 C T 10: 80,188,690 P177L probably damaging Het
Fbxo46 A G 7: 19,135,400 probably benign Het
Gdpd5 A T 7: 99,458,841 T542S probably benign Het
Gm136 T G 4: 34,750,928 D115A possibly damaging Het
Gm7356 T A 17: 14,001,425 K114I possibly damaging Het
Gpr180 G T 14: 118,148,246 E157* probably null Het
Grk4 T C 5: 34,748,309 I466T Het
Hic1 A G 11: 75,169,506 M5T unknown Het
Hmcn2 C A 2: 31,413,673 N3058K probably benign Het
Htr5a T A 5: 27,850,801 H263Q probably benign Het
Lrrc7 T C 3: 158,240,501 K187R probably benign Het
Map3k8 A T 18: 4,340,557 H252Q probably benign Het
Muc4 CAC CACTAC 16: 32,754,076 probably benign Het
Napsa A T 7: 44,585,799 D336V probably damaging Het
Neurod1 T A 2: 79,454,874 N55I possibly damaging Het
Olfr1220 A T 2: 89,097,025 C301S probably benign Het
Olfr1431 T C 19: 12,210,339 F258L probably damaging Het
Olfr874 T A 9: 37,746,667 C178S probably damaging Het
Olfr975 A T 9: 39,950,791 probably benign Het
Pcdha8 G T 18: 36,994,270 G602C probably damaging Het
Peg10 T TCCG 6: 4,756,451 probably benign Het
Pigr G A 1: 130,846,494 V404M probably damaging Het
Plch1 G A 3: 63,704,615 P803L probably damaging Het
Ppp4r3b T A 11: 29,209,396 F583L probably benign Het
Rit2 A T 18: 30,975,415 D172E possibly damaging Het
Skint4 C T 4: 112,165,735 P476S possibly damaging Het
Slco2b1 A G 7: 99,670,964 V353A probably benign Het
Slit3 A G 11: 35,684,090 D1077G probably damaging Het
Sun2 A G 15: 79,728,051 F478L probably benign Het
Syt6 C A 3: 103,587,509 C263* probably null Het
Tfpi C A 2: 84,442,891 L229F unknown Het
Tmem131l A T 3: 83,910,468 C1242S probably benign Het
Ttc3 T A 16: 94,403,360 W280R probably damaging Het
Uncx A G 5: 139,546,818 K213E possibly damaging Het
Usp24 T C 4: 106,375,678 L887P probably benign Het
Vmn1r178 A T 7: 23,893,979 I151F probably damaging Het
Vmn2r50 G T 7: 10,038,134 Q547K possibly damaging Het
Vwf A G 6: 125,648,829 probably benign Het
Wdfy3 A T 5: 101,852,585 V2973D probably benign Het
Zbtb49 T C 5: 38,200,945 M655V probably benign Het
Zc3h3 C T 15: 75,839,650 A321T probably benign Het
Zeb2 T A 2: 45,110,028 R65W possibly damaging Het
Zfp541 A G 7: 16,078,451 E343G probably damaging Het
Zfp775 C A 6: 48,620,217 R342S probably damaging Het
Zwilch A G 9: 64,168,660 F27L probably benign Het
Other mutations in Naa16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00551:Naa16 APN 14 79355729 missense probably damaging 1.00
IGL01025:Naa16 APN 14 79384756 missense probably damaging 1.00
IGL01155:Naa16 APN 14 79384715 missense probably damaging 0.98
IGL01335:Naa16 APN 14 79345116 splice site probably benign
IGL01981:Naa16 APN 14 79381516 missense probably benign 0.05
IGL02230:Naa16 APN 14 79377361 splice site probably benign
IGL02313:Naa16 APN 14 79384668 missense probably damaging 1.00
IGL02418:Naa16 APN 14 79383366 missense probably damaging 1.00
IGL02544:Naa16 APN 14 79335820 missense probably damaging 1.00
IGL03051:Naa16 APN 14 79369082 missense probably benign 0.01
IGL03064:Naa16 APN 14 79339628 missense probably damaging 0.98
IGL03205:Naa16 APN 14 79356512 missense possibly damaging 0.89
PIT4508001:Naa16 UTSW 14 79369087 missense probably benign 0.15
R0651:Naa16 UTSW 14 79351392 missense probably damaging 1.00
R1429:Naa16 UTSW 14 79359527 missense probably benign 0.01
R1674:Naa16 UTSW 14 79387057 start codon destroyed probably null 0.65
R1693:Naa16 UTSW 14 79351456 missense probably damaging 1.00
R1874:Naa16 UTSW 14 79355743 missense possibly damaging 0.62
R1992:Naa16 UTSW 14 79356491 missense probably damaging 1.00
R2015:Naa16 UTSW 14 79345059 missense probably damaging 1.00
R2391:Naa16 UTSW 14 79370049 missense probably benign 0.16
R2847:Naa16 UTSW 14 79335883 missense probably damaging 1.00
R2848:Naa16 UTSW 14 79335883 missense probably damaging 1.00
R2877:Naa16 UTSW 14 79343298 missense probably benign 0.00
R3884:Naa16 UTSW 14 79343262 missense probably damaging 0.98
R4001:Naa16 UTSW 14 79343121 splice site probably null
R4199:Naa16 UTSW 14 79355871 missense probably damaging 1.00
R4638:Naa16 UTSW 14 79340033 splice site probably null
R4676:Naa16 UTSW 14 79336348 unclassified probably benign
R4690:Naa16 UTSW 14 79345057 missense probably damaging 1.00
R4952:Naa16 UTSW 14 79345085 missense probably damaging 1.00
R5087:Naa16 UTSW 14 79377415 missense possibly damaging 0.68
R5104:Naa16 UTSW 14 79384700 nonsense probably null
R5729:Naa16 UTSW 14 79355780 missense probably damaging 1.00
R6178:Naa16 UTSW 14 79383340 missense possibly damaging 0.93
R6960:Naa16 UTSW 14 79359471 missense possibly damaging 0.65
R7794:Naa16 UTSW 14 79377494 missense probably damaging 1.00
R7936:Naa16 UTSW 14 79341046 missense possibly damaging 0.47
R8356:Naa16 UTSW 14 79359475 missense probably benign 0.00
R8456:Naa16 UTSW 14 79359475 missense probably benign 0.00
R8892:Naa16 UTSW 14 79390576 missense probably benign 0.32
R8931:Naa16 UTSW 14 79344955 missense probably damaging 1.00
R9010:Naa16 UTSW 14 79370042 missense probably benign 0.01
R9360:Naa16 UTSW 14 79356503 missense probably benign 0.05
R9688:Naa16 UTSW 14 79335869 nonsense probably null
X0064:Naa16 UTSW 14 79351389 missense probably damaging 1.00
Z1177:Naa16 UTSW 14 79344979 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGTAACTTTCACTATGCTTCAGAAG -3'
(R):5'- TAGCTATCGCCAGGAGGACAG -3'

Sequencing Primer
(F):5'- CTTCAGAAGCTGGCTAAGGAAGTG -3'
(R):5'- AGTGGTTCATTTCTGAAGACAAAC -3'
Posted On 2021-11-19