Incidental Mutation 'R9069:Crybg1'
ID 689437
Institutional Source Beutler Lab
Gene Symbol Crybg1
Ensembl Gene ENSMUSG00000019866
Gene Name crystallin beta-gamma domain containing 1
Synonyms Aim1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9069 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 43950636-44148853 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 43998107 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Valine at position 1002 (F1002V)
Ref Sequence ENSEMBL: ENSMUSP00000143429 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020017] [ENSMUST00000200401]
AlphaFold A0A0G2JG52
Predicted Effect probably benign
Transcript: ENSMUST00000020017
AA Change: F628V

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000020017
Gene: ENSMUSG00000019866
AA Change: F628V

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
low complexity region 114 121 N/A INTRINSIC
low complexity region 176 192 N/A INTRINSIC
low complexity region 436 453 N/A INTRINSIC
low complexity region 507 518 N/A INTRINSIC
low complexity region 544 557 N/A INTRINSIC
low complexity region 837 857 N/A INTRINSIC
XTALbg 995 1078 8.57e-9 SMART
XTALbg 1094 1175 4.73e-20 SMART
XTALbg 1189 1282 1.23e-32 SMART
XTALbg 1290 1373 9.3e-28 SMART
XTALbg 1386 1465 1.66e-24 SMART
XTALbg 1473 1553 5.29e-32 SMART
RICIN 1556 1689 5.86e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200401
AA Change: F1002V

PolyPhen 2 Score 0.297 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000143429
Gene: ENSMUSG00000019866
AA Change: F1002V

DomainStartEndE-ValueType
low complexity region 377 390 N/A INTRINSIC
low complexity region 488 495 N/A INTRINSIC
low complexity region 550 566 N/A INTRINSIC
low complexity region 810 827 N/A INTRINSIC
low complexity region 881 892 N/A INTRINSIC
low complexity region 918 931 N/A INTRINSIC
low complexity region 1211 1231 N/A INTRINSIC
XTALbg 1369 1452 5.4e-11 SMART
XTALbg 1468 1549 2.9e-22 SMART
XTALbg 1563 1656 7.9e-35 SMART
XTALbg 1664 1747 6e-30 SMART
XTALbg 1760 1839 1.1e-26 SMART
XTALbg 1847 1927 3.3e-34 SMART
RICIN 1930 2063 3.3e-17 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (78/78)
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 T A 17: 45,507,597 C103S probably damaging Het
Adamts20 T C 15: 94,338,468 S841G probably benign Het
Add3 T A 19: 53,233,901 V313E possibly damaging Het
Ahr G T 12: 35,512,772 probably benign Het
Ankrd12 T A 17: 66,049,879 M48L probably benign Het
Apaf1 A C 10: 91,023,718 probably null Het
Bank1 T C 3: 136,284,011 H106R probably benign Het
Birc6 A G 17: 74,561,265 probably benign Het
Ccdc170 C T 10: 4,561,016 H692Y possibly damaging Het
Cd93 A G 2: 148,442,151 I425T probably benign Het
Celsr1 A C 15: 86,030,571 L1067R possibly damaging Het
Clca3a2 A T 3: 144,813,686 probably benign Het
Col14a1 T C 15: 55,388,594 S549P unknown Het
Col6a4 A G 9: 106,074,939 S587P possibly damaging Het
Crebbp C A 16: 4,085,323 M2017I probably benign Het
Ctif T C 18: 75,521,387 E356G probably damaging Het
Dbx2 T C 15: 95,632,358 K243E probably damaging Het
Dgkh C T 14: 78,616,517 V394I probably damaging Het
Dnaja4 T A 9: 54,714,354 M321K probably benign Het
Dock9 T C 14: 121,628,912 N593S probably damaging Het
Dot1l T A 10: 80,790,726 S1260R probably damaging Het
Eea1 A T 10: 95,995,648 L200F probably damaging Het
Elp2 T G 18: 24,632,776 F658V probably benign Het
Fbxw15 G A 9: 109,565,400 Q116* probably null Het
Fstl5 A T 3: 76,708,109 N826Y probably damaging Het
Galp T C 7: 6,211,348 S60P possibly damaging Het
Gatsl3 A G 11: 4,220,141 E73G probably benign Het
Gm13103 A G 4: 143,851,775 S202G probably benign Het
Gm4778 A C 3: 94,265,846 S50R possibly damaging Het
Gm7298 G T 6: 121,784,434 M1316I probably benign Het
Gsdmc T C 15: 63,778,053 M330V probably benign Het
Hectd2 T C 19: 36,585,462 F175L probably benign Het
Hmbs A G 9: 44,336,805 I318T possibly damaging Het
Ifi205 T C 1: 174,028,275 D63G probably benign Het
Il10ra T A 9: 45,256,098 Q387L probably damaging Het
Kcnj14 C A 7: 45,819,964 G39V probably benign Het
Kpna1 T C 16: 36,016,011 probably benign Het
Lrp2 A T 2: 69,501,652 D1586E probably damaging Het
Lrrc45 A G 11: 120,717,121 I243V probably benign Het
Lrrc7 T C 3: 158,240,501 K187R probably benign Het
Mamdc4 G T 2: 25,563,359 T1216N probably damaging Het
Map1a A C 2: 121,303,664 K1654Q probably benign Het
Mta2 G A 19: 8,946,740 V195M probably damaging Het
Nav2 G T 7: 49,558,813 R1583L probably damaging Het
Olfr1217 A T 2: 89,023,964 L13Q probably damaging Het
Olfr1393 A T 11: 49,280,420 T91S probably benign Het
Olfr1499 T C 19: 13,815,371 Y73C probably damaging Het
Osbpl1a T A 18: 12,869,017 probably benign Het
Pcdh17 T C 14: 84,447,644 V517A possibly damaging Het
Pcdhb14 T A 18: 37,450,104 C754* probably null Het
Pkd1 T C 17: 24,573,014 V1225A probably damaging Het
Plekhm3 T C 1: 64,921,643 N485D probably benign Het
Plekho1 A C 3: 95,995,683 S14A unknown Het
Ppp2r3a A T 9: 101,212,807 C106S probably benign Het
Ppp6c A C 2: 39,204,916 L99R probably damaging Het
Prkdc T A 16: 15,835,227 Y3855* probably null Het
Ptpru A T 4: 131,776,254 I1155N possibly damaging Het
Reln C T 5: 22,011,061 G1042D probably damaging Het
Sall4 A G 2: 168,754,853 V689A probably benign Het
Sec31b C T 19: 44,519,302 G768S probably damaging Het
Serpinb10 T A 1: 107,546,819 V237D probably benign Het
Serpinb9 T G 13: 33,015,596 D291E probably benign Het
Slc12a7 T G 13: 73,805,970 probably benign Het
Slfn8 A T 11: 83,017,076 F214I probably damaging Het
Slu7 A T 11: 43,438,125 D58V probably damaging Het
Smu1 T C 4: 40,745,558 Y254C probably damaging Het
Snapc4 A T 2: 26,370,793 Y479* probably null Het
Specc1l A G 10: 75,230,806 N30D probably benign Het
Tbck T C 3: 132,722,369 probably null Het
Tcf7l1 T C 6: 72,633,276 Y246C probably damaging Het
Tmem43 C T 6: 91,486,915 R391W possibly damaging Het
Trav7-1 T G 14: 52,655,109 S40A possibly damaging Het
Trim45 T A 3: 100,925,124 Y224* probably null Het
Trio A T 15: 27,852,011 I798N possibly damaging Het
Trnau1ap A T 4: 132,329,351 probably null Het
Vmn1r213 T C 13: 23,011,873 S209P probably damaging Het
Ythdf1 G T 2: 180,911,064 R453S probably damaging Het
Other mutations in Crybg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Crybg1 APN 10 43992509 missense probably damaging 1.00
IGL00502:Crybg1 APN 10 43958313 missense probably damaging 1.00
IGL00848:Crybg1 APN 10 43967818 splice site probably null
IGL01287:Crybg1 APN 10 43992494 missense possibly damaging 0.53
IGL01310:Crybg1 APN 10 43975058 missense possibly damaging 0.95
IGL01310:Crybg1 APN 10 44003600 missense probably damaging 0.99
IGL02683:Crybg1 APN 10 43989216 missense possibly damaging 0.64
IGL03095:Crybg1 APN 10 43989249 missense probably damaging 1.00
R0062:Crybg1 UTSW 10 43997906 missense probably damaging 0.98
R0142:Crybg1 UTSW 10 43999063 missense possibly damaging 0.83
R0294:Crybg1 UTSW 10 43986376 missense probably damaging 1.00
R0539:Crybg1 UTSW 10 43998898 missense probably benign 0.03
R0781:Crybg1 UTSW 10 43999093 missense possibly damaging 0.95
R1110:Crybg1 UTSW 10 43999093 missense possibly damaging 0.95
R1189:Crybg1 UTSW 10 43998794 missense probably damaging 1.00
R1428:Crybg1 UTSW 10 43975078 missense probably benign 0.33
R1521:Crybg1 UTSW 10 43998416 missense probably damaging 1.00
R1688:Crybg1 UTSW 10 43973798 missense probably damaging 1.00
R1728:Crybg1 UTSW 10 44004019 missense probably damaging 0.97
R1756:Crybg1 UTSW 10 43986279 missense probably damaging 1.00
R1773:Crybg1 UTSW 10 43992548 missense possibly damaging 0.91
R1784:Crybg1 UTSW 10 44004019 missense probably damaging 0.97
R1850:Crybg1 UTSW 10 43997674 missense probably damaging 1.00
R1911:Crybg1 UTSW 10 43997677 missense possibly damaging 0.47
R1920:Crybg1 UTSW 10 43997548 missense probably damaging 1.00
R1964:Crybg1 UTSW 10 43958330 missense probably damaging 1.00
R2298:Crybg1 UTSW 10 43999222 missense probably damaging 1.00
R3617:Crybg1 UTSW 10 43956786 missense possibly damaging 0.82
R3913:Crybg1 UTSW 10 43998763 missense possibly damaging 0.95
R4081:Crybg1 UTSW 10 43975039 missense probably damaging 1.00
R4116:Crybg1 UTSW 10 43999162 missense possibly damaging 0.91
R4409:Crybg1 UTSW 10 43998758 missense possibly damaging 0.94
R4583:Crybg1 UTSW 10 43997620 missense probably damaging 1.00
R4721:Crybg1 UTSW 10 43997887 missense probably damaging 1.00
R4818:Crybg1 UTSW 10 43998587 missense probably benign 0.00
R4859:Crybg1 UTSW 10 43992569 missense probably damaging 1.00
R4933:Crybg1 UTSW 10 43999213 missense probably damaging 1.00
R5028:Crybg1 UTSW 10 43998212 missense possibly damaging 0.74
R5057:Crybg1 UTSW 10 43989108 nonsense probably null
R5102:Crybg1 UTSW 10 43997836 missense probably damaging 1.00
R5103:Crybg1 UTSW 10 43997948 missense probably damaging 1.00
R5137:Crybg1 UTSW 10 43958336 missense probably damaging 1.00
R5212:Crybg1 UTSW 10 43967743 missense possibly damaging 0.95
R5307:Crybg1 UTSW 10 44003714 missense probably benign 0.00
R5353:Crybg1 UTSW 10 43973665 missense probably damaging 1.00
R5463:Crybg1 UTSW 10 44003693 nonsense probably null
R5503:Crybg1 UTSW 10 43998766 missense probably benign 0.00
R5583:Crybg1 UTSW 10 44003510 missense probably benign 0.01
R5835:Crybg1 UTSW 10 43975133 missense probably benign 0.28
R6021:Crybg1 UTSW 10 43997538 missense probably damaging 1.00
R6032:Crybg1 UTSW 10 43956760 missense probably damaging 1.00
R6032:Crybg1 UTSW 10 43956760 missense probably damaging 1.00
R6277:Crybg1 UTSW 10 43997259 missense probably benign 0.03
R6338:Crybg1 UTSW 10 43992509 missense probably damaging 1.00
R6348:Crybg1 UTSW 10 44003951 missense probably damaging 1.00
R6514:Crybg1 UTSW 10 43997215 missense probably damaging 1.00
R6785:Crybg1 UTSW 10 43999171 missense probably benign 0.00
R6804:Crybg1 UTSW 10 43966341 missense probably damaging 1.00
R6938:Crybg1 UTSW 10 43997383 missense probably benign 0.01
R6983:Crybg1 UTSW 10 43999342 missense probably damaging 1.00
R7002:Crybg1 UTSW 10 43998835 missense probably damaging 1.00
R7153:Crybg1 UTSW 10 43964666 missense possibly damaging 0.64
R7271:Crybg1 UTSW 10 43997623 nonsense probably null
R7293:Crybg1 UTSW 10 44003432 missense probably damaging 1.00
R7304:Crybg1 UTSW 10 43997258 missense probably benign 0.05
R7313:Crybg1 UTSW 10 43989111 missense probably damaging 0.98
R7373:Crybg1 UTSW 10 44004140 missense probably benign 0.00
R7449:Crybg1 UTSW 10 44004519 missense probably benign
R7530:Crybg1 UTSW 10 43999073 missense possibly damaging 0.62
R7660:Crybg1 UTSW 10 43998835 missense probably damaging 0.97
R7701:Crybg1 UTSW 10 43989143 missense probably benign 0.06
R8359:Crybg1 UTSW 10 43992542 missense probably benign 0.03
R8751:Crybg1 UTSW 10 44004842 missense probably benign 0.04
R8809:Crybg1 UTSW 10 44003432 missense probably damaging 1.00
R9017:Crybg1 UTSW 10 44004481 missense probably benign 0.00
R9099:Crybg1 UTSW 10 43998848 missense probably benign 0.01
R9118:Crybg1 UTSW 10 44003929 missense possibly damaging 0.56
R9185:Crybg1 UTSW 10 44004095 missense probably benign 0.04
R9486:Crybg1 UTSW 10 44004149 start gained probably benign
R9561:Crybg1 UTSW 10 43997432 missense probably benign 0.00
RF005:Crybg1 UTSW 10 44004745 missense probably benign 0.03
RF024:Crybg1 UTSW 10 44004745 missense probably benign 0.03
X0065:Crybg1 UTSW 10 43992526 synonymous silent
Z1088:Crybg1 UTSW 10 43997311 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTCTGGGGCACACATACTGC -3'
(R):5'- TGTCACAGTAATGAGCCTGAAG -3'

Sequencing Primer
(F):5'- GGGCACACATACTGCACTGTC -3'
(R):5'- CAGTAATGAGCCTGAAGTGGTGTC -3'
Posted On 2021-11-19