Incidental Mutation 'R9069:Dock9'
ID 689452
Institutional Source Beutler Lab
Gene Symbol Dock9
Ensembl Gene ENSMUSG00000025558
Gene Name dedicator of cytokinesis 9
Synonyms D14Wsu89e, Zizimin1, B230309H04Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9069 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 121542046-121797837 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 121628912 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 593 (N593S)
Ref Sequence ENSEMBL: ENSMUSP00000148834 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040700] [ENSMUST00000100299] [ENSMUST00000212181] [ENSMUST00000212376]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000040700
AA Change: N593S

PolyPhen 2 Score 0.620 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000047881
Gene: ENSMUSG00000025558
AA Change: N593S

DomainStartEndE-ValueType
Pfam:DUF3398 58 151 5.6e-36 PFAM
PH 172 280 1.38e-16 SMART
Blast:PH 297 372 4e-25 BLAST
Pfam:DOCK-C2 631 822 5.3e-51 PFAM
Pfam:DHR-2 1523 2068 2.1e-212 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000100299
AA Change: N595S

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000097872
Gene: ENSMUSG00000025558
AA Change: N595S

DomainStartEndE-ValueType
Pfam:DUF3398 58 153 1.5e-32 PFAM
PH 174 282 1.38e-16 SMART
Blast:PH 299 374 4e-25 BLAST
Pfam:DOCK-C2 632 825 1.3e-59 PFAM
low complexity region 1752 1763 N/A INTRINSIC
Pfam:Ded_cyto 1836 2013 2.4e-69 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000212181
AA Change: N593S

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect possibly damaging
Transcript: ENSMUST00000212376
AA Change: N607S

PolyPhen 2 Score 0.574 (Sensitivity: 0.88; Specificity: 0.91)
Meta Mutation Damage Score 0.1835 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (78/78)
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 T A 17: 45,507,597 C103S probably damaging Het
Adamts20 T C 15: 94,338,468 S841G probably benign Het
Add3 T A 19: 53,233,901 V313E possibly damaging Het
Ahr G T 12: 35,512,772 probably benign Het
Ankrd12 T A 17: 66,049,879 M48L probably benign Het
Apaf1 A C 10: 91,023,718 probably null Het
Bank1 T C 3: 136,284,011 H106R probably benign Het
Birc6 A G 17: 74,561,265 probably benign Het
Ccdc170 C T 10: 4,561,016 H692Y possibly damaging Het
Cd93 A G 2: 148,442,151 I425T probably benign Het
Celsr1 A C 15: 86,030,571 L1067R possibly damaging Het
Clca3a2 A T 3: 144,813,686 probably benign Het
Col14a1 T C 15: 55,388,594 S549P unknown Het
Col6a4 A G 9: 106,074,939 S587P possibly damaging Het
Crebbp C A 16: 4,085,323 M2017I probably benign Het
Crybg1 A C 10: 43,998,107 F1002V probably benign Het
Ctif T C 18: 75,521,387 E356G probably damaging Het
Dbx2 T C 15: 95,632,358 K243E probably damaging Het
Dgkh C T 14: 78,616,517 V394I probably damaging Het
Dnaja4 T A 9: 54,714,354 M321K probably benign Het
Dot1l T A 10: 80,790,726 S1260R probably damaging Het
Eea1 A T 10: 95,995,648 L200F probably damaging Het
Elp2 T G 18: 24,632,776 F658V probably benign Het
Fbxw15 G A 9: 109,565,400 Q116* probably null Het
Fstl5 A T 3: 76,708,109 N826Y probably damaging Het
Galp T C 7: 6,211,348 S60P possibly damaging Het
Gatsl3 A G 11: 4,220,141 E73G probably benign Het
Gm13103 A G 4: 143,851,775 S202G probably benign Het
Gm4778 A C 3: 94,265,846 S50R possibly damaging Het
Gm7298 G T 6: 121,784,434 M1316I probably benign Het
Gsdmc T C 15: 63,778,053 M330V probably benign Het
Hectd2 T C 19: 36,585,462 F175L probably benign Het
Hmbs A G 9: 44,336,805 I318T possibly damaging Het
Ifi205 T C 1: 174,028,275 D63G probably benign Het
Il10ra T A 9: 45,256,098 Q387L probably damaging Het
Kcnj14 C A 7: 45,819,964 G39V probably benign Het
Kpna1 T C 16: 36,016,011 probably benign Het
Lrp2 A T 2: 69,501,652 D1586E probably damaging Het
Lrrc45 A G 11: 120,717,121 I243V probably benign Het
Lrrc7 T C 3: 158,240,501 K187R probably benign Het
Mamdc4 G T 2: 25,563,359 T1216N probably damaging Het
Map1a A C 2: 121,303,664 K1654Q probably benign Het
Mta2 G A 19: 8,946,740 V195M probably damaging Het
Nav2 G T 7: 49,558,813 R1583L probably damaging Het
Olfr1217 A T 2: 89,023,964 L13Q probably damaging Het
Olfr1393 A T 11: 49,280,420 T91S probably benign Het
Olfr1499 T C 19: 13,815,371 Y73C probably damaging Het
Osbpl1a T A 18: 12,869,017 probably benign Het
Pcdh17 T C 14: 84,447,644 V517A possibly damaging Het
Pcdhb14 T A 18: 37,450,104 C754* probably null Het
Pkd1 T C 17: 24,573,014 V1225A probably damaging Het
Plekhm3 T C 1: 64,921,643 N485D probably benign Het
Plekho1 A C 3: 95,995,683 S14A unknown Het
Ppp2r3a A T 9: 101,212,807 C106S probably benign Het
Ppp6c A C 2: 39,204,916 L99R probably damaging Het
Prkdc T A 16: 15,835,227 Y3855* probably null Het
Ptpru A T 4: 131,776,254 I1155N possibly damaging Het
Reln C T 5: 22,011,061 G1042D probably damaging Het
Sall4 A G 2: 168,754,853 V689A probably benign Het
Sec31b C T 19: 44,519,302 G768S probably damaging Het
Serpinb10 T A 1: 107,546,819 V237D probably benign Het
Serpinb9 T G 13: 33,015,596 D291E probably benign Het
Slc12a7 T G 13: 73,805,970 probably benign Het
Slfn8 A T 11: 83,017,076 F214I probably damaging Het
Slu7 A T 11: 43,438,125 D58V probably damaging Het
Smu1 T C 4: 40,745,558 Y254C probably damaging Het
Snapc4 A T 2: 26,370,793 Y479* probably null Het
Specc1l A G 10: 75,230,806 N30D probably benign Het
Tbck T C 3: 132,722,369 probably null Het
Tcf7l1 T C 6: 72,633,276 Y246C probably damaging Het
Tmem43 C T 6: 91,486,915 R391W possibly damaging Het
Trav7-1 T G 14: 52,655,109 S40A possibly damaging Het
Trim45 T A 3: 100,925,124 Y224* probably null Het
Trio A T 15: 27,852,011 I798N possibly damaging Het
Trnau1ap A T 4: 132,329,351 probably null Het
Vmn1r213 T C 13: 23,011,873 S209P probably damaging Het
Ythdf1 G T 2: 180,911,064 R453S probably damaging Het
Other mutations in Dock9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Dock9 APN 14 121668468 missense probably benign 0.12
IGL00817:Dock9 APN 14 121698291 missense probably damaging 0.96
IGL00923:Dock9 APN 14 121607092 unclassified probably benign
IGL01385:Dock9 APN 14 121580583 missense possibly damaging 0.94
IGL01567:Dock9 APN 14 121653084 missense probably damaging 1.00
IGL01767:Dock9 APN 14 121622870 missense possibly damaging 0.91
IGL01811:Dock9 APN 14 121559028 missense probably damaging 1.00
IGL02512:Dock9 APN 14 121619538 splice site probably benign
IGL02525:Dock9 APN 14 121640126 missense probably damaging 1.00
IGL02550:Dock9 APN 14 121698312 start codon destroyed probably null 0.07
IGL02559:Dock9 APN 14 121625147 splice site probably benign
IGL02666:Dock9 APN 14 121580699 missense probably benign 0.42
IGL02674:Dock9 APN 14 121595611 splice site probably null
IGL02795:Dock9 APN 14 121639978 missense probably benign 0.04
IGL03074:Dock9 APN 14 121607270 missense possibly damaging 0.95
IGL03095:Dock9 APN 14 121639528 missense probably damaging 1.00
IGL03294:Dock9 APN 14 121641623 splice site probably benign
R0036:Dock9 UTSW 14 121622853 missense probably damaging 1.00
R0050:Dock9 UTSW 14 121607225 missense probably benign 0.43
R0050:Dock9 UTSW 14 121607225 missense probably benign 0.43
R0164:Dock9 UTSW 14 121597665 missense probably damaging 1.00
R0164:Dock9 UTSW 14 121597665 missense probably damaging 1.00
R0270:Dock9 UTSW 14 121575999 missense probably benign 0.02
R0494:Dock9 UTSW 14 121662584 missense possibly damaging 0.64
R0726:Dock9 UTSW 14 121651768 nonsense probably null
R1029:Dock9 UTSW 14 121599684 splice site probably null
R1214:Dock9 UTSW 14 121586316 missense probably benign 0.02
R1231:Dock9 UTSW 14 121575950 missense possibly damaging 0.61
R1535:Dock9 UTSW 14 121546064 missense probably damaging 1.00
R1629:Dock9 UTSW 14 121543574 missense possibly damaging 0.88
R1637:Dock9 UTSW 14 121651775 missense possibly damaging 0.66
R1733:Dock9 UTSW 14 121626880 missense probably benign 0.01
R1772:Dock9 UTSW 14 121609798 missense probably benign 0.07
R1855:Dock9 UTSW 14 121640159 missense probably damaging 1.00
R1888:Dock9 UTSW 14 121625205 missense probably benign 0.18
R1888:Dock9 UTSW 14 121625205 missense probably benign 0.18
R1901:Dock9 UTSW 14 121625153 splice site probably null
R1920:Dock9 UTSW 14 121583380 missense probably damaging 1.00
R1987:Dock9 UTSW 14 121591830 missense probably benign 0.00
R3035:Dock9 UTSW 14 121606837 missense possibly damaging 0.60
R3851:Dock9 UTSW 14 121629086 splice site probably null
R4020:Dock9 UTSW 14 121606855 missense probably benign 0.00
R4021:Dock9 UTSW 14 121626912 missense possibly damaging 0.80
R4089:Dock9 UTSW 14 121583471 missense probably damaging 1.00
R4258:Dock9 UTSW 14 121581442 missense probably benign 0.00
R4423:Dock9 UTSW 14 121562053 critical splice donor site probably null
R4561:Dock9 UTSW 14 121559007 missense probably benign 0.01
R4604:Dock9 UTSW 14 121668459 missense probably damaging 1.00
R4646:Dock9 UTSW 14 121586246 missense probably damaging 1.00
R4647:Dock9 UTSW 14 121586246 missense probably damaging 1.00
R4776:Dock9 UTSW 14 121610097 missense possibly damaging 0.81
R4809:Dock9 UTSW 14 121546596 missense probably benign 0.37
R4865:Dock9 UTSW 14 121543505 makesense probably null
R4951:Dock9 UTSW 14 121653135 missense probably benign 0.35
R5151:Dock9 UTSW 14 121578170 missense probably damaging 1.00
R5359:Dock9 UTSW 14 121653060 missense possibly damaging 0.69
R5366:Dock9 UTSW 14 121578203 missense probably damaging 1.00
R5502:Dock9 UTSW 14 121610182 splice site probably null
R5579:Dock9 UTSW 14 121599695 missense probably damaging 1.00
R5753:Dock9 UTSW 14 121634625 missense probably benign 0.05
R5836:Dock9 UTSW 14 121681351 missense probably damaging 1.00
R5858:Dock9 UTSW 14 121628792 missense probably benign 0.00
R5890:Dock9 UTSW 14 121668408 critical splice donor site probably null
R6075:Dock9 UTSW 14 121545973 missense probably benign
R6298:Dock9 UTSW 14 121634594 missense probably damaging 1.00
R6306:Dock9 UTSW 14 121562080 missense probably damaging 1.00
R6321:Dock9 UTSW 14 121546021 missense probably damaging 1.00
R6330:Dock9 UTSW 14 121605243 start codon destroyed probably null 0.00
R6719:Dock9 UTSW 14 121610027 missense probably damaging 1.00
R6784:Dock9 UTSW 14 121543514 missense probably damaging 1.00
R6826:Dock9 UTSW 14 121622918 missense probably damaging 1.00
R6830:Dock9 UTSW 14 121622918 missense probably damaging 1.00
R6838:Dock9 UTSW 14 121546596 missense possibly damaging 0.71
R6868:Dock9 UTSW 14 121586264 missense probably benign 0.37
R6919:Dock9 UTSW 14 121643152 missense probably benign 0.42
R6989:Dock9 UTSW 14 121627379 missense probably damaging 1.00
R7539:Dock9 UTSW 14 121581436 missense probably damaging 1.00
R7645:Dock9 UTSW 14 121597663 missense probably benign 0.44
R7875:Dock9 UTSW 14 121625984 nonsense probably null
R7900:Dock9 UTSW 14 121546079 missense possibly damaging 0.84
R8040:Dock9 UTSW 14 121651794 missense probably benign 0.06
R8420:Dock9 UTSW 14 121546042 missense probably damaging 1.00
R8511:Dock9 UTSW 14 121627389 missense probably benign 0.40
R8511:Dock9 UTSW 14 121681435 missense probably damaging 1.00
R8514:Dock9 UTSW 14 121658787 missense probably benign 0.25
R8691:Dock9 UTSW 14 121640105 missense possibly damaging 0.49
R8804:Dock9 UTSW 14 121605183 missense probably damaging 0.98
R8894:Dock9 UTSW 14 121622961 missense probably benign 0.10
R8900:Dock9 UTSW 14 121580528 missense probably damaging 1.00
R9218:Dock9 UTSW 14 121668459 missense probably damaging 1.00
R9233:Dock9 UTSW 14 121583369 missense probably benign 0.09
R9236:Dock9 UTSW 14 121639558 missense probably damaging 1.00
R9285:Dock9 UTSW 14 121595600 missense probably benign
R9451:Dock9 UTSW 14 121550189 splice site probably benign
R9461:Dock9 UTSW 14 121605189 missense probably benign 0.05
R9484:Dock9 UTSW 14 121581432 missense probably damaging 1.00
R9517:Dock9 UTSW 14 121591824 missense probably benign 0.07
R9542:Dock9 UTSW 14 121627363 missense probably damaging 1.00
R9694:Dock9 UTSW 14 121581379 missense probably damaging 1.00
R9701:Dock9 UTSW 14 121639571 missense probably benign 0.01
R9703:Dock9 UTSW 14 121544577 makesense probably null
R9726:Dock9 UTSW 14 121597737 missense possibly damaging 0.61
R9741:Dock9 UTSW 14 121640104 missense probably damaging 1.00
Z1088:Dock9 UTSW 14 121555275 missense probably damaging 1.00
Z1176:Dock9 UTSW 14 121651782 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTGCCTTGGCAAACGACTTC -3'
(R):5'- TGCCACTTGAGAATTTAGACTTCAC -3'

Sequencing Primer
(F):5'- CTTGGCAAACGACTTCTGGCTG -3'
(R):5'- CTCTTTTGTTTGCAGACCTGAGAAG -3'
Posted On 2021-11-19