Incidental Mutation 'R9069:Gsdmc'
ID689455
Institutional Source Beutler Lab
Gene Symbol Gsdmc
Ensembl Gene ENSMUSG00000079025
Gene Namegasdermin C
SynonymsMlze, Gsdmc1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock #R9069 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location63775968-63808759 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 63778053 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 330 (M330V)
Ref Sequence ENSEMBL: ENSMUSP00000105752 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110125] [ENSMUST00000173503]
AlphaFold Q99NB5
Predicted Effect probably benign
Transcript: ENSMUST00000110125
AA Change: M330V

PolyPhen 2 Score 0.124 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000105752
Gene: ENSMUSG00000079025
AA Change: M330V

DomainStartEndE-ValueType
Pfam:Gasdermin 4 444 6.2e-170 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000173503
AA Change: M321V
SMART Domains Protein: ENSMUSP00000133683
Gene: ENSMUSG00000079025
AA Change: M321V

DomainStartEndE-ValueType
Pfam:Gasdermin 4 435 9.6e-157 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 T A 17: 45,507,597 C103S probably damaging Het
Adamts20 T C 15: 94,338,468 S841G probably benign Het
Add3 T A 19: 53,233,901 V313E possibly damaging Het
Ankrd12 T A 17: 66,049,879 M48L probably benign Het
Apaf1 A C 10: 91,023,718 probably null Het
Bank1 T C 3: 136,284,011 H106R probably benign Het
Ccdc170 C T 10: 4,561,016 H692Y possibly damaging Het
Cd93 A G 2: 148,442,151 I425T probably benign Het
Celsr1 A C 15: 86,030,571 L1067R possibly damaging Het
Col14a1 T C 15: 55,388,594 S549P unknown Het
Col6a4 A G 9: 106,074,939 S587P possibly damaging Het
Crebbp C A 16: 4,085,323 M2017I probably benign Het
Crybg1 A C 10: 43,998,107 F1002V probably benign Het
Ctif T C 18: 75,521,387 E356G probably damaging Het
Dbx2 T C 15: 95,632,358 K243E probably damaging Het
Dgkh C T 14: 78,616,517 V394I probably damaging Het
Dnaja4 T A 9: 54,714,354 M321K probably benign Het
Dock9 T C 14: 121,628,912 N593S probably damaging Het
Dot1l T A 10: 80,790,726 S1260R probably damaging Het
Eea1 A T 10: 95,995,648 L200F probably damaging Het
Elp2 T G 18: 24,632,776 F658V probably benign Het
Fbxw15 G A 9: 109,565,400 Q116* probably null Het
Fstl5 A T 3: 76,708,109 N826Y probably damaging Het
Galp T C 7: 6,211,348 S60P possibly damaging Het
Gatsl3 A G 11: 4,220,141 E73G probably benign Het
Gm13103 A G 4: 143,851,775 S202G probably benign Het
Gm4778 A C 3: 94,265,846 S50R possibly damaging Het
Gm7298 G T 6: 121,784,434 M1316I probably benign Het
Hectd2 T C 19: 36,585,462 F175L probably benign Het
Hmbs A G 9: 44,336,805 I318T possibly damaging Het
Ifi205 T C 1: 174,028,275 D63G probably benign Het
Il10ra T A 9: 45,256,098 Q387L probably damaging Het
Kcnj14 C A 7: 45,819,964 G39V probably benign Het
Lrp2 A T 2: 69,501,652 D1586E probably damaging Het
Lrrc45 A G 11: 120,717,121 I243V probably benign Het
Lrrc7 T C 3: 158,240,501 K187R probably benign Het
Mamdc4 G T 2: 25,563,359 T1216N probably damaging Het
Map1a A C 2: 121,303,664 K1654Q probably benign Het
Mta2 G A 19: 8,946,740 V195M probably damaging Het
Nav2 G T 7: 49,558,813 R1583L probably damaging Het
Olfr1217 A T 2: 89,023,964 L13Q probably damaging Het
Olfr1393 A T 11: 49,280,420 T91S probably benign Het
Olfr1499 T C 19: 13,815,371 Y73C probably damaging Het
Pcdh17 T C 14: 84,447,644 V517A possibly damaging Het
Pcdhb14 T A 18: 37,450,104 C754* probably null Het
Pkd1 T C 17: 24,573,014 V1225A probably damaging Het
Plekhm3 T C 1: 64,921,643 N485D probably benign Het
Plekho1 A C 3: 95,995,683 S14A unknown Het
Ppp2r3a A T 9: 101,212,807 C106S probably benign Het
Ppp6c A C 2: 39,204,916 L99R probably damaging Het
Prkdc T A 16: 15,835,227 Y3855* probably null Het
Ptpru A T 4: 131,776,254 I1155N possibly damaging Het
Reln C T 5: 22,011,061 G1042D probably damaging Het
Sall4 A G 2: 168,754,853 V689A probably benign Het
Sec31b C T 19: 44,519,302 G768S probably damaging Het
Serpinb10 T A 1: 107,546,819 V237D probably benign Het
Serpinb9 T G 13: 33,015,596 D291E probably benign Het
Slfn8 A T 11: 83,017,076 F214I probably damaging Het
Slu7 A T 11: 43,438,125 D58V probably damaging Het
Smu1 T C 4: 40,745,558 Y254C probably damaging Het
Snapc4 A T 2: 26,370,793 Y479* probably null Het
Specc1l A G 10: 75,230,806 N30D probably benign Het
Tbck T C 3: 132,722,369 probably null Het
Tcf7l1 T C 6: 72,633,276 Y246C probably damaging Het
Tmem43 C T 6: 91,486,915 R391W possibly damaging Het
Trav7-1 T G 14: 52,655,109 S40A possibly damaging Het
Trim45 T A 3: 100,925,124 Y224* probably null Het
Trio A T 15: 27,852,011 I798N possibly damaging Het
Trnau1ap A T 4: 132,329,351 probably null Het
Vmn1r213 T C 13: 23,011,873 S209P probably damaging Het
Ythdf1 G T 2: 180,911,064 R453S probably damaging Het
Other mutations in Gsdmc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Gsdmc APN 15 63804421 missense probably benign 0.41
IGL00791:Gsdmc APN 15 63804435 missense possibly damaging 0.85
IGL01889:Gsdmc APN 15 63780003 missense possibly damaging 0.89
IGL01917:Gsdmc APN 15 63778585 missense probably benign
IGL01948:Gsdmc APN 15 63778581 missense probably damaging 1.00
IGL02391:Gsdmc APN 15 63803579 missense probably damaging 0.99
IGL02479:Gsdmc APN 15 63777975 missense possibly damaging 0.87
IGL02551:Gsdmc APN 15 63801933 missense probably benign 0.00
R0115:Gsdmc UTSW 15 63803637 missense probably damaging 0.99
R1523:Gsdmc UTSW 15 63803630 missense probably damaging 0.99
R1655:Gsdmc UTSW 15 63780043 missense probably benign 0.42
R1990:Gsdmc UTSW 15 63801899 missense probably benign 0.12
R1991:Gsdmc UTSW 15 63801899 missense probably benign 0.12
R2267:Gsdmc UTSW 15 63776798 missense probably benign 0.12
R2882:Gsdmc UTSW 15 63779795 missense probably benign 0.24
R2943:Gsdmc UTSW 15 63803652 missense possibly damaging 0.91
R4110:Gsdmc UTSW 15 63780027 missense probably benign 0.08
R4712:Gsdmc UTSW 15 63779537 missense probably benign 0.01
R4963:Gsdmc UTSW 15 63804380 critical splice donor site probably null
R4997:Gsdmc UTSW 15 63776780 missense probably damaging 1.00
R5032:Gsdmc UTSW 15 63802033 missense possibly damaging 0.63
R5276:Gsdmc UTSW 15 63801957 missense probably benign 0.25
R5346:Gsdmc UTSW 15 63776886 missense probably damaging 1.00
R5963:Gsdmc UTSW 15 63780116 splice site probably null
R5965:Gsdmc UTSW 15 63804598 critical splice acceptor site probably null
R6872:Gsdmc UTSW 15 63778707 missense possibly damaging 0.79
R7035:Gsdmc UTSW 15 63778720 splice site probably null
R7408:Gsdmc UTSW 15 63804466 missense probably benign
R7719:Gsdmc UTSW 15 63778964 splice site probably null
R7862:Gsdmc UTSW 15 63777996 missense possibly damaging 0.52
R8528:Gsdmc UTSW 15 63777340 splice site probably null
R8697:Gsdmc UTSW 15 63780034 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- CTCTGACACAGCCCTATGAG -3'
(R):5'- GTGGCCTACTAGTTCTGCTC -3'

Sequencing Primer
(F):5'- TATGAGGACCAACATGAGGACTCTC -3'
(R):5'- AGGGTCTTCCTGGACTACATAGTAAG -3'
Posted On2021-11-19