Incidental Mutation 'R9070:Dpyd'
ID 689479
Institutional Source Beutler Lab
Gene Symbol Dpyd
Ensembl Gene ENSMUSG00000033308
Gene Name dihydropyrimidine dehydrogenase
Synonyms DPD, E330028L06Rik
Accession Numbers

Genbank: NM_170778; MGI: 2139667

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9070 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 118562129-119432924 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 118999243 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Serine at position 533 (I533S)
Ref Sequence ENSEMBL: ENSMUSP00000039429 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039177]
AlphaFold Q8CHR6
Predicted Effect probably damaging
Transcript: ENSMUST00000039177
AA Change: I533S

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000039429
Gene: ENSMUSG00000033308
AA Change: I533S

DomainStartEndE-ValueType
Pfam:Fer4_20 55 168 4.6e-35 PFAM
Pfam:Pyr_redox_2 188 499 1.5e-15 PFAM
Pfam:NAD_binding_8 193 249 5.5e-8 PFAM
Pfam:DHO_dh 532 838 8.1e-36 PFAM
Pfam:Dus 617 822 7.5e-8 PFAM
Pfam:Fer4_10 945 997 7.4e-9 PFAM
Pfam:Fer4_21 946 1004 1.3e-26 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a pyrimidine catabolic enzyme and the initial and rate-limiting factor in the pathway of uracil and thymidine catabolism. Mutations in this gene result in dihydropyrimidine dehydrogenase deficiency, an error in pyrimidine metabolism associated with thymine-uraciluria and an increased risk of toxicity in cancer patients receiving 5-fluorouracil chemotherapy. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]
Allele List at MGI

All alleles(1) : Targeted, other(1)

Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik A T 2: 130,812,873 S159R possibly damaging Het
Adcy5 T C 16: 35,280,400 L774P probably damaging Het
Aldh2 T C 5: 121,568,969 E495G probably damaging Het
Als2cl T C 9: 110,889,220 V343A probably benign Het
Antxrl T A 14: 34,071,714 C466* probably null Het
Arc A G 15: 74,671,984 L130P probably damaging Het
Barhl1 C A 2: 28,915,411 R90L probably benign Het
Baz2a A G 10: 128,123,062 M1149V probably benign Het
Bsn G A 9: 108,110,096 S106L Het
Calu A G 6: 29,356,568 E31G probably benign Het
Cdh23 T G 10: 60,337,760 I1650L probably benign Het
Ceacam9 T C 7: 16,723,862 V100A possibly damaging Het
Fam184a T C 10: 53,638,277 D1016G possibly damaging Het
Fam208a T C 14: 27,472,527 V1228A probably benign Het
Fv1 T A 4: 147,869,957 W327R probably damaging Het
Gbp7 A G 3: 142,544,001 D411G probably benign Het
Gldc A T 19: 30,103,004 D885E probably damaging Het
Gm11361 A G 13: 28,257,919 Y95C probably benign Het
Gm14085 A G 2: 122,521,673 T331A probably damaging Het
Hdgfl2 T C 17: 56,082,371 W82R possibly damaging Het
Hif1an A G 19: 44,563,019 S48G probably benign Het
Hist1h4c A G 13: 23,698,187 V88A probably damaging Het
Itgal C T 7: 127,328,701 R1023W probably null Het
Kif13a C A 13: 46,752,458 A1618S probably benign Het
Lrrc57 A G 2: 120,606,084 L181P probably damaging Het
Mptx2 T A 1: 173,274,552 D190V probably benign Het
Net1 A G 13: 3,886,103 I381T probably damaging Het
Nipbl T A 15: 8,338,731 K1169I possibly damaging Het
Nop9 G A 14: 55,753,300 R563H probably damaging Het
Obscn A T 11: 59,122,631 L1130Q probably damaging Het
Olfr1360 A T 13: 21,674,815 M43K probably benign Het
Olfr341 A T 2: 36,479,256 S291R probably damaging Het
Pcgf1 T A 6: 83,080,095 H202Q probably damaging Het
Pcnx3 A G 19: 5,665,573 L1883P probably benign Het
Pde4b T C 4: 102,601,797 S505P probably damaging Het
Pitpnm2 C A 5: 124,121,312 R1320L probably damaging Het
Pot1a C T 6: 25,744,630 R625Q Het
Pou4f1 A G 14: 104,466,631 S122P probably damaging Het
Ppl A G 16: 5,089,344 V1029A probably benign Het
Prex1 A G 2: 166,585,787 F982L probably damaging Het
Prr27 C A 5: 87,843,135 P202Q probably benign Het
Rbks A G 5: 31,697,546 V19A probably benign Het
Rps20 A T 4: 3,835,280 D5E probably benign Het
Sacs C A 14: 61,210,302 P3266T probably benign Het
Svs1 A G 6: 48,988,395 N446D possibly damaging Het
Trdv5 T C 14: 54,148,801 D69G probably damaging Het
Treml4 G T 17: 48,269,753 G180C probably damaging Het
Other mutations in Dpyd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Dpyd APN 3 118944242 missense probably damaging 1.00
IGL00508:Dpyd APN 3 119064987 missense probably benign 0.06
IGL02113:Dpyd APN 3 118999219 missense probably benign 0.06
IGL02177:Dpyd APN 3 119064910 missense possibly damaging 0.76
IGL03001:Dpyd APN 3 118917242 missense probably benign 0.07
IGL03106:Dpyd APN 3 119195134 missense probably benign 0.03
IGL03399:Dpyd APN 3 119314777 missense probably damaging 0.98
F5770:Dpyd UTSW 3 118897126 nonsense probably null
F6893:Dpyd UTSW 3 118804134 critical splice donor site probably null
R0014:Dpyd UTSW 3 119141935 missense probably damaging 1.00
R0081:Dpyd UTSW 3 118944255 missense probably benign 0.00
R0267:Dpyd UTSW 3 118917272 missense probably benign
R0349:Dpyd UTSW 3 118917099 nonsense probably null
R0387:Dpyd UTSW 3 119427226 missense probably benign 0.21
R0523:Dpyd UTSW 3 118899203 missense probably benign
R0555:Dpyd UTSW 3 119431542 missense probably damaging 1.00
R0652:Dpyd UTSW 3 119427275 missense probably damaging 1.00
R0741:Dpyd UTSW 3 118674505 missense possibly damaging 0.79
R1313:Dpyd UTSW 3 118899161 splice site probably benign
R1554:Dpyd UTSW 3 119065046 splice site probably null
R1610:Dpyd UTSW 3 119065006 missense probably benign
R1710:Dpyd UTSW 3 118610443 critical splice acceptor site probably null
R1861:Dpyd UTSW 3 118917131 missense probably damaging 1.00
R2103:Dpyd UTSW 3 119064952 missense probably benign 0.02
R2130:Dpyd UTSW 3 118674568 missense probably benign
R2131:Dpyd UTSW 3 118674568 missense probably benign
R2882:Dpyd UTSW 3 119065030 missense probably damaging 0.99
R3771:Dpyd UTSW 3 119412278 critical splice donor site probably null
R3978:Dpyd UTSW 3 118897088 critical splice acceptor site probably benign
R3978:Dpyd UTSW 3 118897089 critical splice acceptor site probably benign
R4030:Dpyd UTSW 3 118897166 missense probably benign 0.03
R4065:Dpyd UTSW 3 118897089 critical splice acceptor site probably benign
R4066:Dpyd UTSW 3 118897089 critical splice acceptor site probably benign
R4234:Dpyd UTSW 3 119431584 missense probably damaging 1.00
R4502:Dpyd UTSW 3 118797537 missense probably damaging 1.00
R4638:Dpyd UTSW 3 119266077 missense probably benign 0.03
R4980:Dpyd UTSW 3 118917118 missense probably damaging 0.99
R5262:Dpyd UTSW 3 118797422 nonsense probably null
R5348:Dpyd UTSW 3 118781943 missense probably benign
R5587:Dpyd UTSW 3 119064951 missense probably damaging 1.00
R5611:Dpyd UTSW 3 119194293 missense probably benign
R5665:Dpyd UTSW 3 118917092 missense probably damaging 1.00
R5716:Dpyd UTSW 3 118899179 missense probably damaging 1.00
R5786:Dpyd UTSW 3 119427237 missense probably damaging 0.97
R6046:Dpyd UTSW 3 119431575 missense probably benign 0.01
R6404:Dpyd UTSW 3 119265957 missense probably benign 0.02
R6703:Dpyd UTSW 3 118897200 splice site probably null
R7037:Dpyd UTSW 3 118899289 missense probably benign 0.00
R7215:Dpyd UTSW 3 119266032 missense probably benign 0.11
R7301:Dpyd UTSW 3 118899284 missense possibly damaging 0.90
R7336:Dpyd UTSW 3 119064921 missense probably damaging 1.00
R7714:Dpyd UTSW 3 118804131 missense probably benign 0.01
R8238:Dpyd UTSW 3 119195193 splice site probably null
R8306:Dpyd UTSW 3 119412173 missense probably benign
R8315:Dpyd UTSW 3 119314885 missense probably benign 0.09
R8321:Dpyd UTSW 3 118781924 missense possibly damaging 0.84
R8342:Dpyd UTSW 3 119314803 missense possibly damaging 0.60
R8735:Dpyd UTSW 3 119141916 missense possibly damaging 0.74
R8750:Dpyd UTSW 3 119141936 missense probably damaging 1.00
R8874:Dpyd UTSW 3 118999332 missense probably damaging 1.00
R8910:Dpyd UTSW 3 118610518 missense probably benign 0.17
R8973:Dpyd UTSW 3 119314933 critical splice donor site probably null
R9132:Dpyd UTSW 3 118917248 missense probably damaging 1.00
R9198:Dpyd UTSW 3 118759654 critical splice acceptor site probably null
R9260:Dpyd UTSW 3 119314798 missense possibly damaging 0.95
R9307:Dpyd UTSW 3 119314911 missense probably benign
V7581:Dpyd UTSW 3 118897126 nonsense probably null
V7582:Dpyd UTSW 3 118897126 nonsense probably null
V7583:Dpyd UTSW 3 118897126 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAGGAGTCTGAATTCATTTGCATGC -3'
(R):5'- GGGATGAGAGTGATTGTTTAAACAC -3'

Sequencing Primer
(F):5'- CTGAATTCATTTGCATGCTATGAGG -3'
(R):5'- GGATCCTTGTGCCTTGCAGAAAAC -3'
Posted On 2021-11-19