Incidental Mutation 'R9070:Pot1a'
ID 689488
Institutional Source Beutler Lab
Gene Symbol Pot1a
Ensembl Gene ENSMUSG00000029676
Gene Name protection of telomeres 1A
Synonyms 1500031H18Rik, Pot1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9070 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 25743737-25809246 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 25744630 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Glutamine at position 625 (R625Q)
Ref Sequence ENSEMBL: ENSMUSP00000110986 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115330] [ENSMUST00000166445]
AlphaFold Q91WC1
Predicted Effect
SMART Domains Protein: ENSMUSP00000110986
Gene: ENSMUSG00000029676
AA Change: R625Q

DomainStartEndE-ValueType
Telo_bind 11 141 3.6e-53 SMART
Pfam:POT1PC 152 299 6.7e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166445
AA Change: R625Q

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000131928
Gene: ENSMUSG00000029676
AA Change: R625Q

DomainStartEndE-ValueType
Telo_bind 11 141 3.6e-53 SMART
low complexity region 253 260 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the telombin family and encodes a nuclear protein involved in telomere maintenance. Specifically, this protein functions as a member of a multi-protein complex that binds to the TTAGGG repeats of telomeres, regulating telomere length and protecting chromosome ends from illegitimate recombination, catastrophic chromosome instability, and abnormal chromosome segregation. Increased transcriptional expression of this gene is associated with stomach carcinogenesis and its progression. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to complete prenatal lethality. Embryos homozygous for a gene trapped allele fail to form an inner cell mass in culture. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik A T 2: 130,812,873 S159R possibly damaging Het
Adcy5 T C 16: 35,280,400 L774P probably damaging Het
Aldh2 T C 5: 121,568,969 E495G probably damaging Het
Als2cl T C 9: 110,889,220 V343A probably benign Het
Antxrl T A 14: 34,071,714 C466* probably null Het
Arc A G 15: 74,671,984 L130P probably damaging Het
Barhl1 C A 2: 28,915,411 R90L probably benign Het
Baz2a A G 10: 128,123,062 M1149V probably benign Het
Bsn G A 9: 108,110,096 S106L Het
Calu A G 6: 29,356,568 E31G probably benign Het
Cdh23 T G 10: 60,337,760 I1650L probably benign Het
Ceacam9 T C 7: 16,723,862 V100A possibly damaging Het
Dpyd T G 3: 118,999,243 I533S probably damaging Het
Fam184a T C 10: 53,638,277 D1016G possibly damaging Het
Fam208a T C 14: 27,472,527 V1228A probably benign Het
Fv1 T A 4: 147,869,957 W327R probably damaging Het
Gbp7 A G 3: 142,544,001 D411G probably benign Het
Gldc A T 19: 30,103,004 D885E probably damaging Het
Gm11361 A G 13: 28,257,919 Y95C probably benign Het
Gm14085 A G 2: 122,521,673 T331A probably damaging Het
Hdgfl2 T C 17: 56,082,371 W82R possibly damaging Het
Hif1an A G 19: 44,563,019 S48G probably benign Het
Hist1h4c A G 13: 23,698,187 V88A probably damaging Het
Itgal C T 7: 127,328,701 R1023W probably null Het
Kif13a C A 13: 46,752,458 A1618S probably benign Het
Lrrc57 A G 2: 120,606,084 L181P probably damaging Het
Mptx2 T A 1: 173,274,552 D190V probably benign Het
Net1 A G 13: 3,886,103 I381T probably damaging Het
Nipbl T A 15: 8,338,731 K1169I possibly damaging Het
Nop9 G A 14: 55,753,300 R563H probably damaging Het
Obscn A T 11: 59,122,631 L1130Q probably damaging Het
Olfr1360 A T 13: 21,674,815 M43K probably benign Het
Olfr341 A T 2: 36,479,256 S291R probably damaging Het
Pcgf1 T A 6: 83,080,095 H202Q probably damaging Het
Pcnx3 A G 19: 5,665,573 L1883P probably benign Het
Pde4b T C 4: 102,601,797 S505P probably damaging Het
Pitpnm2 C A 5: 124,121,312 R1320L probably damaging Het
Pou4f1 A G 14: 104,466,631 S122P probably damaging Het
Ppl A G 16: 5,089,344 V1029A probably benign Het
Prex1 A G 2: 166,585,787 F982L probably damaging Het
Prr27 C A 5: 87,843,135 P202Q probably benign Het
Rbks A G 5: 31,697,546 V19A probably benign Het
Rps20 A T 4: 3,835,280 D5E probably benign Het
Sacs C A 14: 61,210,302 P3266T probably benign Het
Svs1 A G 6: 48,988,395 N446D possibly damaging Het
Trdv5 T C 14: 54,148,801 D69G probably damaging Het
Treml4 G T 17: 48,269,753 G180C probably damaging Het
Other mutations in Pot1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00857:Pot1a APN 6 25744628 missense probably benign 0.01
IGL01393:Pot1a APN 6 25744631 nonsense probably null
IGL01411:Pot1a APN 6 25750144 splice site probably benign
IGL01774:Pot1a APN 6 25753277 missense probably benign 0.00
IGL01981:Pot1a APN 6 25750100 missense probably damaging 1.00
IGL02404:Pot1a APN 6 25764432 splice site probably benign
IGL02530:Pot1a APN 6 25794593 missense probably damaging 1.00
IGL02755:Pot1a APN 6 25771613 missense possibly damaging 0.81
IGL03127:Pot1a APN 6 25794616 missense probably benign 0.00
IGL03396:Pot1a APN 6 25745914 missense possibly damaging 0.93
BB001:Pot1a UTSW 6 25753310 missense possibly damaging 0.94
BB011:Pot1a UTSW 6 25753310 missense possibly damaging 0.94
R0329:Pot1a UTSW 6 25778831 splice site probably benign
R0359:Pot1a UTSW 6 25771680 splice site probably benign
R0530:Pot1a UTSW 6 25771541 missense possibly damaging 0.86
R0840:Pot1a UTSW 6 25748284 splice site probably benign
R0918:Pot1a UTSW 6 25756268 missense possibly damaging 0.92
R1650:Pot1a UTSW 6 25745965 missense probably damaging 1.00
R1937:Pot1a UTSW 6 25753324 missense probably benign 0.15
R2142:Pot1a UTSW 6 25750044 splice site probably null
R4072:Pot1a UTSW 6 25752357 splice site probably null
R4074:Pot1a UTSW 6 25752357 splice site probably null
R4322:Pot1a UTSW 6 25745930 missense probably benign 0.02
R4895:Pot1a UTSW 6 25753206 missense probably damaging 1.00
R4910:Pot1a UTSW 6 25746021 intron probably benign
R4933:Pot1a UTSW 6 25771541 missense possibly damaging 0.86
R5530:Pot1a UTSW 6 25778894 missense probably damaging 1.00
R5748:Pot1a UTSW 6 25758856 missense possibly damaging 0.77
R5775:Pot1a UTSW 6 25757298 splice site probably null
R5870:Pot1a UTSW 6 25778951 missense possibly damaging 0.90
R6180:Pot1a UTSW 6 25771621 missense probably benign 0.00
R6377:Pot1a UTSW 6 25778870 missense probably benign 0.06
R7251:Pot1a UTSW 6 25752498 splice site probably null
R7457:Pot1a UTSW 6 25771622 missense probably benign 0.26
R7679:Pot1a UTSW 6 25771634 missense probably benign 0.16
R7717:Pot1a UTSW 6 25758823 missense probably benign 0.45
R7924:Pot1a UTSW 6 25753310 missense possibly damaging 0.94
R8078:Pot1a UTSW 6 25750108 missense probably benign 0.13
R8084:Pot1a UTSW 6 25771536 missense possibly damaging 0.81
R8170:Pot1a UTSW 6 25758803 makesense probably null
Predicted Primers PCR Primer
(F):5'- ACCTCCCACGACATGATGAG -3'
(R):5'- AGCCCTGAAAGGTTGGGATG -3'

Sequencing Primer
(F):5'- CATGATGAGCAACAAGGGATTTTTG -3'
(R):5'- GAATTATGACAGCTGTCTTCTGC -3'
Posted On 2021-11-19