Incidental Mutation 'R9070:Gldc'
ID 689518
Institutional Source Beutler Lab
Gene Symbol Gldc
Ensembl Gene ENSMUSG00000024827
Gene Name glycine decarboxylase
Synonyms b2b2679Clo, D030049L12Rik, D19Wsu57e
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9070 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 30075847-30152829 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 30080404 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 885 (D885E)
Ref Sequence ENSEMBL: ENSMUSP00000025778 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025778]
AlphaFold Q91W43
Predicted Effect probably damaging
Transcript: ENSMUST00000025778
AA Change: D885E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025778
Gene: ENSMUSG00000024827
AA Change: D885E

DomainStartEndE-ValueType
low complexity region 5 28 N/A INTRINSIC
low complexity region 33 56 N/A INTRINSIC
Pfam:GDC-P 70 493 1.1e-202 PFAM
low complexity region 504 515 N/A INTRINSIC
Pfam:GDC-P 519 798 6.5e-8 PFAM
Pfam:Beta_elim_lyase 589 745 2e-10 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Degradation of glycine is brought about by the glycine cleavage system, which is composed of four mitochondrial protein components: P protein (a pyridoxal phosphate-dependent glycine decarboxylase), H protein (a lipoic acid-containing protein), T protein (a tetrahydrofolate-requiring enzyme), and L protein (a lipoamide dehydrogenase). The protein encoded by this gene is the P protein, which binds to glycine and enables the methylamine group from glycine to be transferred to the T protein. Defects in this gene are a cause of nonketotic hyperglycinemia (NKH).[provided by RefSeq, Jan 2010]
PHENOTYPE: Hypomorphic mutants show a developmental delay, hyperglycinemia, altered folate profiles, neural tube defects and postnatal lethality, while survivors show hydrocephaly and premature death. Homozygotes for an ENU allele show omphalocele and severe cardiovascular, craniofacial, renal and eye defects. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, other(2) Gene trapped(4)

Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy5 T C 16: 35,100,770 (GRCm39) L774P probably damaging Het
Aldh2 T C 5: 121,707,032 (GRCm39) E495G probably damaging Het
Als2cl T C 9: 110,718,288 (GRCm39) V343A probably benign Het
Antxrl T A 14: 33,793,671 (GRCm39) C466* probably null Het
Aoc1l3 A G 6: 48,965,329 (GRCm39) N446D possibly damaging Het
Arc A G 15: 74,543,833 (GRCm39) L130P probably damaging Het
Barhl1 C A 2: 28,805,423 (GRCm39) R90L probably benign Het
Baz2a A G 10: 127,958,931 (GRCm39) M1149V probably benign Het
Bsn G A 9: 107,987,295 (GRCm39) S106L Het
Calu A G 6: 29,356,567 (GRCm39) E31G probably benign Het
Cdh23 T G 10: 60,173,539 (GRCm39) I1650L probably benign Het
Ceacam9 T C 7: 16,457,787 (GRCm39) V100A possibly damaging Het
Dnaaf9 A T 2: 130,654,793 (GRCm39) S159R possibly damaging Het
Dpyd T G 3: 118,792,892 (GRCm39) I533S probably damaging Het
Fam184a T C 10: 53,514,373 (GRCm39) D1016G possibly damaging Het
Fv1 T A 4: 147,954,414 (GRCm39) W327R probably damaging Het
Gbp7 A G 3: 142,249,762 (GRCm39) D411G probably benign Het
H4c3 A G 13: 23,882,170 (GRCm39) V88A probably damaging Het
Hdgfl2 T C 17: 56,389,371 (GRCm39) W82R possibly damaging Het
Hif1an A G 19: 44,551,458 (GRCm39) S48G probably benign Het
Itgal C T 7: 126,927,873 (GRCm39) R1023W probably null Het
Kif13a C A 13: 46,905,934 (GRCm39) A1618S probably benign Het
Lrrc57 A G 2: 120,436,565 (GRCm39) L181P probably damaging Het
Mptx2 T A 1: 173,102,119 (GRCm39) D190V probably benign Het
Mroh5 A G 15: 73,656,688 (GRCm39) F590L probably damaging Het
Net1 A G 13: 3,936,103 (GRCm39) I381T probably damaging Het
Nipbl T A 15: 8,368,215 (GRCm39) K1169I possibly damaging Het
Nop9 G A 14: 55,990,757 (GRCm39) R563H probably damaging Het
Obscn A T 11: 59,013,457 (GRCm39) L1130Q probably damaging Het
Or1j13 A T 2: 36,369,268 (GRCm39) S291R probably damaging Het
Or2b2b A T 13: 21,858,985 (GRCm39) M43K probably benign Het
Pcgf1 T A 6: 83,057,076 (GRCm39) H202Q probably damaging Het
Pcnx3 A G 19: 5,715,601 (GRCm39) L1883P probably benign Het
Pde4b T C 4: 102,458,994 (GRCm39) S505P probably damaging Het
Pitpnm2 C A 5: 124,259,375 (GRCm39) R1320L probably damaging Het
Plscr4 C A 9: 92,372,281 (GRCm39) probably benign Het
Pot1a C T 6: 25,744,629 (GRCm39) R625Q Het
Pou4f1 A G 14: 104,704,067 (GRCm39) S122P probably damaging Het
Ppl A G 16: 4,907,208 (GRCm39) V1029A probably benign Het
Prex1 A G 2: 166,427,707 (GRCm39) F982L probably damaging Het
Prr27 C A 5: 87,990,994 (GRCm39) P202Q probably benign Het
Rbks A G 5: 31,854,890 (GRCm39) V19A probably benign Het
Rps18-ps5 A G 13: 28,441,902 (GRCm39) Y95C probably benign Het
Rps20 A T 4: 3,835,280 (GRCm39) D5E probably benign Het
Sacs C A 14: 61,447,751 (GRCm39) P3266T probably benign Het
Septin7 A G 9: 25,175,507 (GRCm39) probably benign Het
Slc28a2b A G 2: 122,352,154 (GRCm39) T331A probably damaging Het
Tasor T C 14: 27,194,484 (GRCm39) V1228A probably benign Het
Trdv5 T C 14: 54,386,258 (GRCm39) D69G probably damaging Het
Treml4 G T 17: 48,576,781 (GRCm39) G180C probably damaging Het
Other mutations in Gldc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Gldc APN 19 30,092,640 (GRCm39) missense probably damaging 1.00
IGL01016:Gldc APN 19 30,110,893 (GRCm39) missense possibly damaging 0.93
IGL01112:Gldc APN 19 30,135,913 (GRCm39) critical splice donor site probably null
IGL01510:Gldc APN 19 30,091,121 (GRCm39) critical splice donor site probably null
IGL01516:Gldc APN 19 30,076,432 (GRCm39) missense probably damaging 1.00
IGL01598:Gldc APN 19 30,111,156 (GRCm39) missense probably damaging 1.00
IGL01646:Gldc APN 19 30,078,165 (GRCm39) missense possibly damaging 0.61
IGL02024:Gldc APN 19 30,078,227 (GRCm39) missense probably damaging 1.00
IGL02125:Gldc APN 19 30,124,641 (GRCm39) missense probably benign 0.03
IGL02548:Gldc APN 19 30,077,299 (GRCm39) missense probably benign
IGL02711:Gldc APN 19 30,122,546 (GRCm39) critical splice donor site probably null
IGL02818:Gldc APN 19 30,113,909 (GRCm39) missense probably damaging 0.99
IGL02982:Gldc APN 19 30,122,545 (GRCm39) critical splice donor site probably null
IGL03165:Gldc APN 19 30,076,393 (GRCm39) missense possibly damaging 0.61
jojoba UTSW 19 30,110,912 (GRCm39) missense probably damaging 1.00
miserable UTSW 19 30,128,936 (GRCm39) missense probably damaging 1.00
Urchin UTSW 19 30,096,002 (GRCm39) missense probably damaging 0.98
I2289:Gldc UTSW 19 30,124,576 (GRCm39) nonsense probably null
R0180:Gldc UTSW 19 30,078,217 (GRCm39) missense possibly damaging 0.95
R0269:Gldc UTSW 19 30,096,002 (GRCm39) missense probably damaging 0.98
R0277:Gldc UTSW 19 30,093,851 (GRCm39) missense possibly damaging 0.84
R1085:Gldc UTSW 19 30,128,828 (GRCm39) missense probably damaging 1.00
R1159:Gldc UTSW 19 30,138,162 (GRCm39) intron probably benign
R1500:Gldc UTSW 19 30,091,225 (GRCm39) missense possibly damaging 0.88
R1507:Gldc UTSW 19 30,096,038 (GRCm39) missense probably damaging 1.00
R1592:Gldc UTSW 19 30,138,077 (GRCm39) intron probably benign
R1593:Gldc UTSW 19 30,091,150 (GRCm39) missense probably damaging 1.00
R1675:Gldc UTSW 19 30,120,853 (GRCm39) missense probably damaging 1.00
R1869:Gldc UTSW 19 30,116,732 (GRCm39) missense probably benign
R1965:Gldc UTSW 19 30,114,513 (GRCm39) nonsense probably null
R2312:Gldc UTSW 19 30,078,226 (GRCm39) missense probably damaging 0.98
R2425:Gldc UTSW 19 30,109,190 (GRCm39) missense probably damaging 1.00
R3836:Gldc UTSW 19 30,096,075 (GRCm39) splice site probably benign
R3837:Gldc UTSW 19 30,096,075 (GRCm39) splice site probably benign
R3839:Gldc UTSW 19 30,096,075 (GRCm39) splice site probably benign
R4191:Gldc UTSW 19 30,123,058 (GRCm39) missense probably damaging 0.96
R4380:Gldc UTSW 19 30,138,168 (GRCm39) intron probably benign
R4508:Gldc UTSW 19 30,120,807 (GRCm39) missense probably damaging 1.00
R4570:Gldc UTSW 19 30,151,839 (GRCm39) missense probably benign
R4655:Gldc UTSW 19 30,138,102 (GRCm39) intron probably benign
R4842:Gldc UTSW 19 30,111,132 (GRCm39) missense possibly damaging 0.94
R5070:Gldc UTSW 19 30,095,998 (GRCm39) missense possibly damaging 0.84
R5085:Gldc UTSW 19 30,128,936 (GRCm39) missense probably damaging 1.00
R5268:Gldc UTSW 19 30,123,125 (GRCm39) missense probably damaging 0.96
R5368:Gldc UTSW 19 30,135,921 (GRCm39) missense probably benign
R5718:Gldc UTSW 19 30,088,172 (GRCm39) nonsense probably null
R5878:Gldc UTSW 19 30,120,867 (GRCm39) splice site probably null
R6192:Gldc UTSW 19 30,111,172 (GRCm39) missense probably damaging 0.98
R6453:Gldc UTSW 19 30,093,917 (GRCm39) missense probably damaging 0.99
R6777:Gldc UTSW 19 30,110,912 (GRCm39) missense probably damaging 1.00
R6865:Gldc UTSW 19 30,111,162 (GRCm39) missense possibly damaging 0.92
R7332:Gldc UTSW 19 30,093,926 (GRCm39) missense probably damaging 0.99
R7390:Gldc UTSW 19 30,077,314 (GRCm39) missense possibly damaging 0.46
R7647:Gldc UTSW 19 30,096,067 (GRCm39) missense probably damaging 0.96
R8081:Gldc UTSW 19 30,135,987 (GRCm39) frame shift probably null
R8171:Gldc UTSW 19 30,111,161 (GRCm39) missense probably benign 0.24
R8321:Gldc UTSW 19 30,120,807 (GRCm39) nonsense probably null
R8374:Gldc UTSW 19 30,114,594 (GRCm39) missense probably damaging 1.00
R8503:Gldc UTSW 19 30,077,254 (GRCm39) missense probably benign 0.26
R8510:Gldc UTSW 19 30,093,905 (GRCm39) missense probably damaging 1.00
R8785:Gldc UTSW 19 30,092,634 (GRCm39) missense probably damaging 1.00
R8818:Gldc UTSW 19 30,078,212 (GRCm39) missense probably benign 0.05
R8820:Gldc UTSW 19 30,078,212 (GRCm39) missense probably benign 0.05
R8829:Gldc UTSW 19 30,078,212 (GRCm39) missense probably benign 0.05
R8830:Gldc UTSW 19 30,078,212 (GRCm39) missense probably benign 0.05
R8859:Gldc UTSW 19 30,116,779 (GRCm39) missense probably damaging 1.00
R8887:Gldc UTSW 19 30,111,156 (GRCm39) missense possibly damaging 0.94
R8935:Gldc UTSW 19 30,109,093 (GRCm39) missense probably benign 0.00
R8940:Gldc UTSW 19 30,128,884 (GRCm39) missense probably benign
R9100:Gldc UTSW 19 30,077,314 (GRCm39) missense possibly damaging 0.81
R9144:Gldc UTSW 19 30,114,593 (GRCm39) missense
R9163:Gldc UTSW 19 30,111,686 (GRCm39) missense probably benign 0.13
R9429:Gldc UTSW 19 30,091,172 (GRCm39) missense possibly damaging 0.88
Z1177:Gldc UTSW 19 30,123,148 (GRCm39) missense possibly damaging 0.61
Z1177:Gldc UTSW 19 30,088,179 (GRCm39) missense probably damaging 0.99
Z1177:Gldc UTSW 19 30,088,178 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATAGGAGGCCCGCATATGAC -3'
(R):5'- GTATCAAGTTCGCTTCGCCC -3'

Sequencing Primer
(F):5'- CATGAATGGATGACCTATTGGC -3'
(R):5'- AGTTCGCTTCGCCCCCTTG -3'
Posted On 2021-11-19