Incidental Mutation 'R9071:Cspp1'
ID689520
Institutional Source Beutler Lab
Gene Symbol Cspp1
Ensembl Gene ENSMUSG00000056763
Gene Namecentrosome and spindle pole associated protein 1
Synonyms2310020J12Rik, 4930413O22Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.203) question?
Stock #R9071 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location10037987-10136768 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 10088896 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 516 (I516F)
Ref Sequence ENSEMBL: ENSMUSP00000068804 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071087] [ENSMUST00000186294]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000071087
AA Change: I516F

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000068804
Gene: ENSMUSG00000056763
AA Change: I516F

DomainStartEndE-ValueType
low complexity region 10 24 N/A INTRINSIC
low complexity region 270 285 N/A INTRINSIC
coiled coil region 349 383 N/A INTRINSIC
low complexity region 426 447 N/A INTRINSIC
low complexity region 465 484 N/A INTRINSIC
coiled coil region 568 610 N/A INTRINSIC
Pfam:CCDC66 661 810 2e-11 PFAM
coiled coil region 866 903 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000186294
AA Change: I512F

PolyPhen 2 Score 0.746 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000139775
Gene: ENSMUSG00000056763
AA Change: I512F

DomainStartEndE-ValueType
low complexity region 266 281 N/A INTRINSIC
coiled coil region 345 379 N/A INTRINSIC
low complexity region 422 443 N/A INTRINSIC
low complexity region 461 480 N/A INTRINSIC
SCOP:d1eq1a_ 567 748 4e-3 SMART
coiled coil region 811 848 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000188449
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a centrosome and spindle pole associated protein. The encoded protein plays a role in cell-cycle progression and spindle organization, regulates cytokinesis, interacts with Nephrocystin 8 and is required for cilia formation. Mutations in this gene result in primary cilia abnormalities and classical Joubert syndrome. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Apr 2014]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik G T 7: 41,625,359 R162L probably benign Het
Alpi A G 1: 87,098,862 V469A probably damaging Het
Amotl2 G T 9: 102,718,693 probably benign Het
Ano3 T A 2: 110,795,073 probably null Het
Atg16l1 G T 1: 87,756,185 probably benign Het
Atg2b C A 12: 105,658,840 E626* probably null Het
Card6 TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG 15: 5,098,691 probably benign Het
Ccdc162 G A 10: 41,581,178 Q1588* probably null Het
Cd3d A T 9: 44,985,042 H43L probably benign Het
Cenpk C T 13: 104,242,362 Q164* probably null Het
Clybl C A 14: 122,371,285 D96E probably benign Het
Cog1 T C 11: 113,656,113 V511A probably damaging Het
Crhr1 T A 11: 104,173,307 I282N probably damaging Het
Crybg2 A G 4: 134,091,231 N1433D probably damaging Het
Cul9 T C 17: 46,526,453 T1030A probably benign Het
Cyp2d10 T C 15: 82,404,160 T313A probably damaging Het
Ddx11 T A 17: 66,143,741 N549K probably damaging Het
Ddx41 A G 13: 55,532,406 V391A probably damaging Het
Eif3a T C 19: 60,763,196 D1227G unknown Het
Fam83f T C 15: 80,692,005 Y286H probably damaging Het
Fasn T C 11: 120,817,498 D647G probably damaging Het
Fat4 T C 3: 38,983,449 V3750A probably benign Het
Gm34653 T C 2: 34,838,423 V78A probably benign Het
Golga2 T C 2: 32,288,352 S14P probably damaging Het
Hgsnat A G 8: 25,946,274 V584A possibly damaging Het
Ifi207 A T 1: 173,730,198 F325I unknown Het
Igfals A T 17: 24,880,696 I254F probably damaging Het
Matr3 T C 18: 35,572,750 Y243H possibly damaging Het
Mki67 G C 7: 135,699,476 D1276E probably benign Het
Moap1 T A 12: 102,743,105 K62* probably null Het
Myt1 A T 2: 181,806,627 D697V possibly damaging Het
Nampt T A 12: 32,842,782 V356E probably damaging Het
Nell2 T A 15: 95,346,801 K472* probably null Het
Nfe2l3 A C 6: 51,457,263 S268R probably benign Het
Olfr902 T C 9: 38,449,736 I288T possibly damaging Het
Osbpl10 G T 9: 115,061,840 V99L probably benign Het
Pik3cg GAGGACTGCGGTGACATACCTGGAATTTCTGGAAGGACTGCGGTGACATACCTGGAATTTCTGGAAGGACTGCGGTGACATACCTGGAATTTCTGGAAGGACTGCGGTGACATACCTGGAATTTCTGGAAGGACTGCGGTGACATACCTGGAATTTCTGGAAG GAGGACTGCGGTGACATACCTGGAATTTCTGGAAGGACTGCGGTGACATACCTGGAATTTCTGGAAGGACTGCGGTGACATACCTGGAATTTCTGGAAGGACTGCGGTGACATACCTGGAATTTCTGGAAG 12: 32,191,933 probably null Het
Plod2 A G 9: 92,602,995 I537M probably benign Het
Prdm4 A G 10: 85,893,212 L770P probably benign Het
Prr27 C A 5: 87,843,135 P202Q probably benign Het
Scaper T C 9: 55,864,519 D371G probably benign Het
Sema3e A G 5: 14,232,140 K430R probably benign Het
Slco1a5 A T 6: 142,250,326 I317N possibly damaging Het
Spata4 T G 8: 54,602,707 F211C probably damaging Het
Sspo A G 6: 48,457,048 E929G probably benign Het
Tas2r125 A T 6: 132,910,437 N263Y probably benign Het
Ugt3a2 T A 15: 9,370,138 L456* probably null Het
Wdr20rt G A 12: 65,227,448 V562I probably benign Het
Zc3h7b T C 15: 81,793,763 *983Q probably null Het
Zfp28 T A 7: 6,394,545 C660S probably damaging Het
Other mutations in Cspp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00426:Cspp1 APN 1 10112551 unclassified probably benign
IGL01070:Cspp1 APN 1 10088145 missense probably damaging 0.99
IGL01384:Cspp1 APN 1 10116680 missense probably damaging 1.00
IGL01400:Cspp1 APN 1 10085931 missense probably damaging 0.99
IGL01893:Cspp1 APN 1 10134141 splice site probably null
IGL01909:Cspp1 APN 1 10066661 missense probably benign 0.01
IGL02229:Cspp1 APN 1 10083556 missense probably damaging 1.00
IGL02397:Cspp1 APN 1 10108465 missense possibly damaging 0.66
IGL02983:Cspp1 APN 1 10127525 missense probably benign 0.34
IGL03352:Cspp1 APN 1 10047437 missense possibly damaging 0.93
PIT4453001:Cspp1 UTSW 1 10074872 missense possibly damaging 0.83
R0312:Cspp1 UTSW 1 10058829 splice site probably benign
R0782:Cspp1 UTSW 1 10129974 splice site probably benign
R0931:Cspp1 UTSW 1 10104286 missense probably damaging 0.98
R1499:Cspp1 UTSW 1 10088966 splice site probably null
R1553:Cspp1 UTSW 1 10085897 missense possibly damaging 0.94
R1613:Cspp1 UTSW 1 10133241 missense probably damaging 1.00
R1644:Cspp1 UTSW 1 10126438 missense probably damaging 0.99
R2042:Cspp1 UTSW 1 10112538 missense probably damaging 0.98
R2090:Cspp1 UTSW 1 10090268 missense possibly damaging 0.89
R2178:Cspp1 UTSW 1 10104246 missense possibly damaging 0.81
R2247:Cspp1 UTSW 1 10066460 missense possibly damaging 0.87
R2680:Cspp1 UTSW 1 10104305 missense probably damaging 1.00
R3803:Cspp1 UTSW 1 10126373 missense probably damaging 1.00
R4520:Cspp1 UTSW 1 10134227 missense probably benign 0.11
R4531:Cspp1 UTSW 1 10066847 intron probably benign
R4906:Cspp1 UTSW 1 10082328 missense possibly damaging 0.82
R4960:Cspp1 UTSW 1 10126463 missense probably damaging 1.00
R4973:Cspp1 UTSW 1 10126463 missense probably damaging 1.00
R4976:Cspp1 UTSW 1 10126463 missense probably damaging 1.00
R4978:Cspp1 UTSW 1 10083517 missense possibly damaging 0.66
R4979:Cspp1 UTSW 1 10126463 missense probably damaging 1.00
R4981:Cspp1 UTSW 1 10126463 missense probably damaging 1.00
R4983:Cspp1 UTSW 1 10126463 missense probably damaging 1.00
R5032:Cspp1 UTSW 1 10066519 missense probably benign 0.07
R5057:Cspp1 UTSW 1 10074961 splice site probably benign
R5081:Cspp1 UTSW 1 10047466 missense possibly damaging 0.57
R5119:Cspp1 UTSW 1 10126463 missense probably damaging 1.00
R5121:Cspp1 UTSW 1 10126463 missense probably damaging 1.00
R5146:Cspp1 UTSW 1 10074876 nonsense probably null
R5373:Cspp1 UTSW 1 10134126 missense probably damaging 1.00
R5374:Cspp1 UTSW 1 10134126 missense probably damaging 1.00
R6230:Cspp1 UTSW 1 10077197 missense probably benign 0.01
R6291:Cspp1 UTSW 1 10064334 missense probably damaging 0.97
R6382:Cspp1 UTSW 1 10083475 splice site probably null
R7135:Cspp1 UTSW 1 10088936 missense possibly damaging 0.92
R7388:Cspp1 UTSW 1 10065347 nonsense probably null
R7647:Cspp1 UTSW 1 10135937 missense probably benign 0.26
R7722:Cspp1 UTSW 1 10074901 missense probably benign 0.00
R8039:Cspp1 UTSW 1 10113013 missense probably benign 0.02
R8087:Cspp1 UTSW 1 10104264 missense possibly damaging 0.81
R8339:Cspp1 UTSW 1 10113667 missense probably damaging 1.00
R8719:Cspp1 UTSW 1 10090291 missense possibly damaging 0.83
R8774:Cspp1 UTSW 1 10112914 missense possibly damaging 0.46
R8774-TAIL:Cspp1 UTSW 1 10112914 missense possibly damaging 0.46
R8979:Cspp1 UTSW 1 10064405 missense probably benign 0.27
R9068:Cspp1 UTSW 1 10077244 critical splice donor site probably null
R9080:Cspp1 UTSW 1 10113694 missense probably benign 0.25
R9139:Cspp1 UTSW 1 10116650 missense probably damaging 0.99
Z1088:Cspp1 UTSW 1 10083546 missense possibly damaging 0.81
Z1177:Cspp1 UTSW 1 10095878 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TGGACAGACTGTAGCAATAGCC -3'
(R):5'- CCATGCAATGTTACAGATGCAC -3'

Sequencing Primer
(F):5'- GCAACTGAGGAACTTTGTAGTCCC -3'
(R):5'- CATGCAATGTTACAGATGCACTAAAC -3'
Posted On2021-11-19