Mutagenetix > Incidental Mutation

Incidental Mutation 'R9071:Ano3'

689526

Institutional Source

Beutler Lab

Gene Symbol

Ano3

Ensembl Gene

ENSMUSG00000074968

Gene Name

anoctamin 3

Synonyms

Tmem16c, B230324K02Rik

MMRRC Submission

Accession Numbers

Genbank: NM_001081556, NM_001128103; MGI: 3613666

Is this an essential gene?

Probably non essential (E-score: 0.077) question?

Stock #

R9071 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

110655201-110950923 bp(-) (GRCm38)

Type of Mutation

critical splice acceptor site

DNA Base Change (assembly)

T to A at 110795073 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000097219 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099623]

AlphaFold

A2AHL1

Predicted Effect

probably null
Transcript: ENSMUST00000099623

SMART Domains

Protein: ENSMUSP00000097219
Gene: ENSMUSG00000074968

Domain	Start	End	E-Value	Type
Pfam:Anoct_dimer	156	381	2.9e-70	PFAM
Pfam:Anoctamin	384	950	4.4e-138	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

100% (52/52)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the TMEM16 family of predicted membrane proteins, that are also known as anoctamins. While little is known about the function of this gene, mutations in this gene have been associated with some cases of autosomal dominant craniocervical dystonia. Cells from individuals with a mutation in this gene exhibited abnormalities in endoplasmic reticulum-dependent calcium signaling. Studies in rat show that the rat ortholog of this protein interacts with, and modulates the activity of a sodium-activated potassium channel. Deletion of this gene caused increased pain sensitivity in the rat model system. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610021A01Rik	G	T	7: 41,625,359	R162L	probably benign	Het
Alpi	A	G	1: 87,098,862	V469A	probably damaging	Het
Amotl2	G	T	9: 102,718,693		probably benign	Het
Atg16l1	G	T	1: 87,756,185		probably benign	Het
Atg2b	C	A	12: 105,658,840	E626*	probably null	Het
Card6	TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG	TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG	15: 5,098,691		probably benign	Het
Ccdc162	G	A	10: 41,581,178	Q1588*	probably null	Het
Cd3d	A	T	9: 44,985,042	H43L	probably benign	Het
Cenpk	C	T	13: 104,242,362	Q164*	probably null	Het
Clybl	C	A	14: 122,371,285	D96E	probably benign	Het
Cog1	T	C	11: 113,656,113	V511A	probably damaging	Het
Crhr1	T	A	11: 104,173,307	I282N	probably damaging	Het
Crybg2	A	G	4: 134,091,231	N1433D	probably damaging	Het
Cspp1	A	T	1: 10,088,896	I516F	possibly damaging	Het
Cul9	T	C	17: 46,526,453	T1030A	probably benign	Het
Cyp2d10	T	C	15: 82,404,160	T313A	probably damaging	Het
Ddx11	T	A	17: 66,143,741	N549K	probably damaging	Het
Ddx41	A	G	13: 55,532,406	V391A	probably damaging	Het
Eif3a	T	C	19: 60,763,196	D1227G	unknown	Het
Fam83f	T	C	15: 80,692,005	Y286H	probably damaging	Het
Fasn	T	C	11: 120,817,498	D647G	probably damaging	Het
Fat4	T	C	3: 38,983,449	V3750A	probably benign	Het
Gm34653	T	C	2: 34,838,423	V78A	probably benign	Het
Golga2	T	C	2: 32,288,352	S14P	probably damaging	Het
Hgsnat	A	G	8: 25,946,274	V584A	possibly damaging	Het
Ifi207	A	T	1: 173,730,198	F325I	unknown	Het
Igfals	A	T	17: 24,880,696	I254F	probably damaging	Het
Matr3	T	C	18: 35,572,750	Y243H	possibly damaging	Het
Mki67	G	C	7: 135,699,476	D1276E	probably benign	Het
Moap1	T	A	12: 102,743,105	K62*	probably null	Het
Msto1	C	A	3: 88,905,107		probably benign	Het
Myt1	A	T	2: 181,806,627	D697V	possibly damaging	Het
Nampt	T	A	12: 32,842,782	V356E	probably damaging	Het
Nell2	T	A	15: 95,346,801	K472*	probably null	Het
Nfe2l3	A	C	6: 51,457,263	S268R	probably benign	Het
Olfr902	T	C	9: 38,449,736	I288T	possibly damaging	Het
Osbpl10	G	T	9: 115,061,840	V99L	probably benign	Het
Plod2	A	G	9: 92,602,995	I537M	probably benign	Het
Prdm4	A	G	10: 85,893,212	L770P	probably benign	Het
Prr27	C	A	5: 87,843,135	P202Q	probably benign	Het
Scaper	T	C	9: 55,864,519	D371G	probably benign	Het
Sema3e	A	G	5: 14,232,140	K430R	probably benign	Het
Sez6l	A	T	5: 112,425,737		probably benign	Het
Slco1a5	A	T	6: 142,250,326	I317N	possibly damaging	Het
Spata4	T	G	8: 54,602,707	F211C	probably damaging	Het
Sspo	A	G	6: 48,457,048	E929G	probably benign	Het
Sult1e1	A	C	5: 87,587,822		probably benign	Het
Tas2r125	A	T	6: 132,910,437	N263Y	probably benign	Het
Ugt3a2	T	A	15: 9,370,138	L456*	probably null	Het
Wdr20rt	G	A	12: 65,227,448	V562I	probably benign	Het
Zc3h7b	T	C	15: 81,793,763	*983Q	probably null	Het
Zfp28	T	A	7: 6,394,545	C660S	probably damaging	Het

Other mutations in Ano3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00502:Ano3	APN	2	110771050	splice site	probably benign
IGL01066:Ano3	APN	2	110661445	missense	probably null	0.00
IGL01696:Ano3	APN	2	110667737	missense	probably damaging	1.00
IGL01729:Ano3	APN	2	110781394	splice site	probably null
IGL01785:Ano3	APN	2	110682715	missense	probably damaging	1.00
IGL01786:Ano3	APN	2	110682715	missense	probably damaging	1.00
IGL01992:Ano3	APN	2	110658219	missense	probably damaging	1.00
IGL02098:Ano3	APN	2	110666441	nonsense	probably null
IGL02333:Ano3	APN	2	110697199	splice site	probably benign
IGL02346:Ano3	APN	2	110770926	splice site	probably benign
IGL02352:Ano3	APN	2	110884943	nonsense	probably null
IGL02359:Ano3	APN	2	110884943	nonsense	probably null
IGL02544:Ano3	APN	2	110658249	missense	possibly damaging	0.79
IGL02750:Ano3	APN	2	110665984	splice site	probably benign
IGL02861:Ano3	APN	2	110738812	missense	probably damaging	1.00
IGL02948:Ano3	APN	2	110697018	splice site	probably benign
IGL03327:Ano3	APN	2	110697178	missense	possibly damaging	0.62
3-1:Ano3	UTSW	2	110697124	missense	probably damaging	1.00
IGL02988:Ano3	UTSW	2	110775010	missense	probably damaging	1.00
IGL03147:Ano3	UTSW	2	110697418	missense	probably damaging	1.00
R0349:Ano3	UTSW	2	110661487	missense	probably damaging	1.00
R0426:Ano3	UTSW	2	110661174	missense	probably damaging	1.00
R0523:Ano3	UTSW	2	110884855	missense	probably benign	0.13
R0557:Ano3	UTSW	2	110862952	splice site	probably null
R0611:Ano3	UTSW	2	110885001	missense	possibly damaging	0.93
R0891:Ano3	UTSW	2	110697976	missense	probably benign	0.03
R1459:Ano3	UTSW	2	110880829	missense	probably benign	0.00
R1460:Ano3	UTSW	2	110682758	missense	probably damaging	0.97
R1773:Ano3	UTSW	2	110761455	missense	probably damaging	1.00
R1874:Ano3	UTSW	2	110884872	missense	probably benign	0.00
R1919:Ano3	UTSW	2	110885007	missense	probably benign
R2185:Ano3	UTSW	2	110775045	missense	probably benign	0.01
R2280:Ano3	UTSW	2	110682759	missense	probably benign	0.22
R2281:Ano3	UTSW	2	110682759	missense	probably benign	0.22
R2348:Ano3	UTSW	2	110783743	missense	possibly damaging	0.82
R2425:Ano3	UTSW	2	110862843	missense	probably benign
R2697:Ano3	UTSW	2	110794960	missense	possibly damaging	0.79
R3888:Ano3	UTSW	2	110885000	missense	probably damaging	0.99
R3923:Ano3	UTSW	2	110770959	missense	probably damaging	1.00
R4352:Ano3	UTSW	2	110745894	missense	possibly damaging	0.74
R4447:Ano3	UTSW	2	110761578	splice site	probably null
R4790:Ano3	UTSW	2	110884919	missense	probably benign
R4832:Ano3	UTSW	2	110667722	missense	probably damaging	1.00
R4916:Ano3	UTSW	2	110771020	missense	possibly damaging	0.74
R5113:Ano3	UTSW	2	110661480	missense	possibly damaging	0.61
R5486:Ano3	UTSW	2	110745870	missense	probably damaging	1.00
R5498:Ano3	UTSW	2	110697103	missense	possibly damaging	0.68
R5589:Ano3	UTSW	2	110884995	missense	probably damaging	0.99
R5627:Ano3	UTSW	2	110756953	missense	possibly damaging	0.61
R5741:Ano3	UTSW	2	110658273	missense	probably benign	0.11
R5767:Ano3	UTSW	2	110661271	missense	probably damaging	1.00
R5883:Ano3	UTSW	2	110880864	missense	probably null	0.15
R5899:Ano3	UTSW	2	110862887	missense	probably benign	0.39
R5916:Ano3	UTSW	2	110681836	missense	probably benign	0.29
R6158:Ano3	UTSW	2	110665875	missense	probably damaging	1.00
R6315:Ano3	UTSW	2	110697039	missense	probably damaging	1.00
R6401:Ano3	UTSW	2	110775114	missense	probably benign	0.01
R6481:Ano3	UTSW	2	110795027	missense	probably benign	0.16
R6482:Ano3	UTSW	2	110697055	missense	probably damaging	1.00
R6587:Ano3	UTSW	2	110797904	splice site	probably null
R6811:Ano3	UTSW	2	110880867	missense	probably benign	0.03
R7048:Ano3	UTSW	2	110682771	nonsense	probably null
R7145:Ano3	UTSW	2	110862860	missense	probably benign	0.31
R7207:Ano3	UTSW	2	110781423	missense	probably damaging	0.96
R7215:Ano3	UTSW	2	110665932	missense	probably damaging	1.00
R7366:Ano3	UTSW	2	110757067	missense	probably damaging	1.00
R7371:Ano3	UTSW	2	110884849	critical splice donor site	probably null
R7568:Ano3	UTSW	2	110950293	start gained	probably benign
R7636:Ano3	UTSW	2	110682703	nonsense	probably null
R7888:Ano3	UTSW	2	110666428	missense	probably damaging	1.00
R7992:Ano3	UTSW	2	110775022	missense	possibly damaging	0.77
R8024:Ano3	UTSW	2	110667783	missense	probably damaging	0.99
R8074:Ano3	UTSW	2	110950232	start gained	probably benign
R8111:Ano3	UTSW	2	110783713	missense	possibly damaging	0.95
R8177:Ano3	UTSW	2	110666456	missense	probably damaging	1.00
R8297:Ano3	UTSW	2	110661271	missense	probably damaging	1.00
R8485:Ano3	UTSW	2	110667855	critical splice acceptor site	probably null
R8509:Ano3	UTSW	2	110665835	missense	possibly damaging	0.50
R8870:Ano3	UTSW	2	110783729	missense	probably benign	0.12
R9072:Ano3	UTSW	2	110745898	missense	probably benign	0.06
R9073:Ano3	UTSW	2	110745898	missense	probably benign	0.06
R9315:Ano3	UTSW	2	110697942	missense	probably damaging	0.97
R9376:Ano3	UTSW	2	110666437	missense	probably damaging	1.00
R9588:Ano3	UTSW	2	110697997	missense	not run
RF012:Ano3	UTSW	2	110697523	missense	possibly damaging	0.83
RF013:Ano3	UTSW	2	110697036	missense	probably benign	0.30
X0058:Ano3	UTSW	2	110697418	missense	probably damaging	1.00
Z1088:Ano3	UTSW	2	110745847	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACTGCAAAATTAGCCATACCCTTTG -3'
(R):5'- ACATCTGGACATGGCTTAGTC -3'

Sequencing Primer
(F):5'- CCCTTTGAAAATGGTTTAACGTG -3'
(R):5'- GATCATCCATCAAATTACAAACTTGC -3'

Posted On

2021-11-19