Incidental Mutation 'R9071:Tas2r125'
ID 689534
Institutional Source Beutler Lab
Gene Symbol Tas2r125
Ensembl Gene ENSMUSG00000059410
Gene Name taste receptor, type 2, member 125
Synonyms mGR25, Tas2r25, mt2r59, T2R26
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock # R9071 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 132909651-132910587 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 132910437 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Tyrosine at position 263 (N263Y)
Ref Sequence ENSEMBL: ENSMUSP00000075483 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076119]
AlphaFold Q7M710
Predicted Effect probably benign
Transcript: ENSMUST00000076119
AA Change: N263Y

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000075483
Gene: ENSMUSG00000059410
AA Change: N263Y

DomainStartEndE-ValueType
Pfam:TAS2R 1 300 1.1e-90 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik G T 7: 41,625,359 R162L probably benign Het
Alpi A G 1: 87,098,862 V469A probably damaging Het
Amotl2 G T 9: 102,718,693 probably benign Het
Ano3 T A 2: 110,795,073 probably null Het
Atg16l1 G T 1: 87,756,185 probably benign Het
Atg2b C A 12: 105,658,840 E626* probably null Het
Card6 TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG 15: 5,098,691 probably benign Het
Ccdc162 G A 10: 41,581,178 Q1588* probably null Het
Cd3d A T 9: 44,985,042 H43L probably benign Het
Cenpk C T 13: 104,242,362 Q164* probably null Het
Clybl C A 14: 122,371,285 D96E probably benign Het
Cog1 T C 11: 113,656,113 V511A probably damaging Het
Crhr1 T A 11: 104,173,307 I282N probably damaging Het
Crybg2 A G 4: 134,091,231 N1433D probably damaging Het
Cspp1 A T 1: 10,088,896 I516F possibly damaging Het
Cul9 T C 17: 46,526,453 T1030A probably benign Het
Cyp2d10 T C 15: 82,404,160 T313A probably damaging Het
Ddx11 T A 17: 66,143,741 N549K probably damaging Het
Ddx41 A G 13: 55,532,406 V391A probably damaging Het
Eif3a T C 19: 60,763,196 D1227G unknown Het
Fam83f T C 15: 80,692,005 Y286H probably damaging Het
Fasn T C 11: 120,817,498 D647G probably damaging Het
Fat4 T C 3: 38,983,449 V3750A probably benign Het
Gm34653 T C 2: 34,838,423 V78A probably benign Het
Golga2 T C 2: 32,288,352 S14P probably damaging Het
Hgsnat A G 8: 25,946,274 V584A possibly damaging Het
Ifi207 A T 1: 173,730,198 F325I unknown Het
Igfals A T 17: 24,880,696 I254F probably damaging Het
Matr3 T C 18: 35,572,750 Y243H possibly damaging Het
Mki67 G C 7: 135,699,476 D1276E probably benign Het
Moap1 T A 12: 102,743,105 K62* probably null Het
Myt1 A T 2: 181,806,627 D697V possibly damaging Het
Nampt T A 12: 32,842,782 V356E probably damaging Het
Nell2 T A 15: 95,346,801 K472* probably null Het
Nfe2l3 A C 6: 51,457,263 S268R probably benign Het
Olfr902 T C 9: 38,449,736 I288T possibly damaging Het
Osbpl10 G T 9: 115,061,840 V99L probably benign Het
Pik3cg GAGGACTGCGGTGACATACCTGGAATTTCTGGAAGGACTGCGGTGACATACCTGGAATTTCTGGAAGGACTGCGGTGACATACCTGGAATTTCTGGAAGGACTGCGGTGACATACCTGGAATTTCTGGAAGGACTGCGGTGACATACCTGGAATTTCTGGAAG GAGGACTGCGGTGACATACCTGGAATTTCTGGAAGGACTGCGGTGACATACCTGGAATTTCTGGAAGGACTGCGGTGACATACCTGGAATTTCTGGAAGGACTGCGGTGACATACCTGGAATTTCTGGAAG 12: 32,191,933 probably null Het
Plod2 A G 9: 92,602,995 I537M probably benign Het
Prdm4 A G 10: 85,893,212 L770P probably benign Het
Prr27 C A 5: 87,843,135 P202Q probably benign Het
Scaper T C 9: 55,864,519 D371G probably benign Het
Sema3e A G 5: 14,232,140 K430R probably benign Het
Slco1a5 A T 6: 142,250,326 I317N possibly damaging Het
Spata4 T G 8: 54,602,707 F211C probably damaging Het
Sspo A G 6: 48,457,048 E929G probably benign Het
Ugt3a2 T A 15: 9,370,138 L456* probably null Het
Wdr20rt G A 12: 65,227,448 V562I probably benign Het
Zc3h7b T C 15: 81,793,763 *983Q probably null Het
Zfp28 T A 7: 6,394,545 C660S probably damaging Het
Other mutations in Tas2r125
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03252:Tas2r125 APN 6 132910590 splice site probably null
R0090:Tas2r125 UTSW 6 132910398 missense probably benign 0.21
R0725:Tas2r125 UTSW 6 132910122 missense probably benign 0.44
R1901:Tas2r125 UTSW 6 132910176 missense probably benign 0.13
R1902:Tas2r125 UTSW 6 132910176 missense probably benign 0.13
R2679:Tas2r125 UTSW 6 132910227 missense probably benign 0.43
R4770:Tas2r125 UTSW 6 132909787 missense probably damaging 1.00
R4784:Tas2r125 UTSW 6 132909903 missense probably benign 0.16
R5795:Tas2r125 UTSW 6 132909658 missense probably damaging 1.00
R7535:Tas2r125 UTSW 6 132910324 missense probably damaging 1.00
R7820:Tas2r125 UTSW 6 132909878 missense probably benign 0.02
Z1177:Tas2r125 UTSW 6 132909656 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGCACTCAGTTTCCCAGACTTG -3'
(R):5'- CACTACTAAAGAGCATTGACAGAG -3'

Sequencing Primer
(F):5'- CCAGACTTGTCCTTTTAATCAACAC -3'
(R):5'- CATTGACAGAGTATTTCAGGGAAC -3'
Posted On 2021-11-19