Incidental Mutation 'R9071:Plod2'
ID 689544
Institutional Source Beutler Lab
Gene Symbol Plod2
Ensembl Gene ENSMUSG00000032374
Gene Name procollagen lysine, 2-oxoglutarate 5-dioxygenase 2
Synonyms D530025C14Rik, Plod-2, LH2, lysyl hydroxylase 2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9071 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 92542223-92608428 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 92602995 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Methionine at position 537 (I537M)
Ref Sequence ENSEMBL: ENSMUSP00000125373 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070522] [ENSMUST00000160359]
AlphaFold Q9R0B9
Predicted Effect possibly damaging
Transcript: ENSMUST00000070522
AA Change: I516M

PolyPhen 2 Score 0.468 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000068611
Gene: ENSMUSG00000032374
AA Change: I516M

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 181 193 N/A INTRINSIC
low complexity region 307 321 N/A INTRINSIC
Blast:P4Hc 453 500 1e-22 BLAST
P4Hc 563 736 6.38e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160359
AA Change: I537M

PolyPhen 2 Score 0.093 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000125373
Gene: ENSMUSG00000032374
AA Change: I537M

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 181 193 N/A INTRINSIC
low complexity region 307 321 N/A INTRINSIC
Blast:P4Hc 453 500 1e-22 BLAST
P4Hc 584 757 6.38e-21 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane-bound homodimeric enzyme that is localized to the cisternae of the rough endoplasmic reticulum. The enzyme (cofactors iron and ascorbate) catalyzes the hydroxylation of lysyl residues in collagen-like peptides. The resultant hydroxylysyl groups are attachment sites for carbohydrates in collagen and thus are critical for the stability of intermolecular crosslinks. Some patients with Ehlers-Danlos syndrome type VIB have deficiencies in lysyl hydroxylase activity. Mutations in the coding region of this gene are associated with Bruck syndrome. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik G T 7: 41,625,359 R162L probably benign Het
Alpi A G 1: 87,098,862 V469A probably damaging Het
Amotl2 G T 9: 102,718,693 probably benign Het
Ano3 T A 2: 110,795,073 probably null Het
Atg16l1 G T 1: 87,756,185 probably benign Het
Atg2b C A 12: 105,658,840 E626* probably null Het
Card6 TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG 15: 5,098,691 probably benign Het
Ccdc162 G A 10: 41,581,178 Q1588* probably null Het
Cd3d A T 9: 44,985,042 H43L probably benign Het
Cenpk C T 13: 104,242,362 Q164* probably null Het
Clybl C A 14: 122,371,285 D96E probably benign Het
Cog1 T C 11: 113,656,113 V511A probably damaging Het
Crhr1 T A 11: 104,173,307 I282N probably damaging Het
Crybg2 A G 4: 134,091,231 N1433D probably damaging Het
Cspp1 A T 1: 10,088,896 I516F possibly damaging Het
Cul9 T C 17: 46,526,453 T1030A probably benign Het
Cyp2d10 T C 15: 82,404,160 T313A probably damaging Het
Ddx11 T A 17: 66,143,741 N549K probably damaging Het
Ddx41 A G 13: 55,532,406 V391A probably damaging Het
Eif3a T C 19: 60,763,196 D1227G unknown Het
Fam83f T C 15: 80,692,005 Y286H probably damaging Het
Fasn T C 11: 120,817,498 D647G probably damaging Het
Fat4 T C 3: 38,983,449 V3750A probably benign Het
Gm34653 T C 2: 34,838,423 V78A probably benign Het
Golga2 T C 2: 32,288,352 S14P probably damaging Het
Hgsnat A G 8: 25,946,274 V584A possibly damaging Het
Ifi207 A T 1: 173,730,198 F325I unknown Het
Igfals A T 17: 24,880,696 I254F probably damaging Het
Matr3 T C 18: 35,572,750 Y243H possibly damaging Het
Mki67 G C 7: 135,699,476 D1276E probably benign Het
Moap1 T A 12: 102,743,105 K62* probably null Het
Msto1 C A 3: 88,905,107 probably benign Het
Myt1 A T 2: 181,806,627 D697V possibly damaging Het
Nampt T A 12: 32,842,782 V356E probably damaging Het
Nell2 T A 15: 95,346,801 K472* probably null Het
Nfe2l3 A C 6: 51,457,263 S268R probably benign Het
Olfr902 T C 9: 38,449,736 I288T possibly damaging Het
Osbpl10 G T 9: 115,061,840 V99L probably benign Het
Prdm4 A G 10: 85,893,212 L770P probably benign Het
Prr27 C A 5: 87,843,135 P202Q probably benign Het
Scaper T C 9: 55,864,519 D371G probably benign Het
Sema3e A G 5: 14,232,140 K430R probably benign Het
Sez6l A T 5: 112,425,737 probably benign Het
Slco1a5 A T 6: 142,250,326 I317N possibly damaging Het
Spata4 T G 8: 54,602,707 F211C probably damaging Het
Sspo A G 6: 48,457,048 E929G probably benign Het
Sult1e1 A C 5: 87,587,822 probably benign Het
Tas2r125 A T 6: 132,910,437 N263Y probably benign Het
Ugt3a2 T A 15: 9,370,138 L456* probably null Het
Wdr20rt G A 12: 65,227,448 V562I probably benign Het
Zc3h7b T C 15: 81,793,763 *983Q probably null Het
Zfp28 T A 7: 6,394,545 C660S probably damaging Het
Other mutations in Plod2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00715:Plod2 APN 9 92598614 missense probably damaging 0.99
IGL00945:Plod2 APN 9 92584496 missense probably benign 0.08
IGL01386:Plod2 APN 9 92606602 missense probably damaging 0.99
IGL01519:Plod2 APN 9 92595295 missense probably benign 0.00
IGL01836:Plod2 APN 9 92606498 splice site probably benign
IGL02490:Plod2 APN 9 92586842 missense probably benign 0.00
IGL02496:Plod2 APN 9 92607094 missense probably damaging 1.00
IGL02699:Plod2 APN 9 92607142 missense probably damaging 1.00
IGL02735:Plod2 APN 9 92595389 splice site probably benign
IGL03106:Plod2 APN 9 92573567 missense probably damaging 0.98
R0270:Plod2 UTSW 9 92584521 missense probably benign 0.10
R0546:Plod2 UTSW 9 92595335 missense probably damaging 1.00
R0589:Plod2 UTSW 9 92593746 missense probably benign
R0707:Plod2 UTSW 9 92605427 missense possibly damaging 0.91
R1491:Plod2 UTSW 9 92606584 missense probably benign 0.00
R1572:Plod2 UTSW 9 92603067 splice site probably benign
R1731:Plod2 UTSW 9 92584604 critical splice donor site probably null
R1895:Plod2 UTSW 9 92607135 missense probably damaging 1.00
R1917:Plod2 UTSW 9 92581257 missense probably benign
R1946:Plod2 UTSW 9 92607135 missense probably damaging 1.00
R3850:Plod2 UTSW 9 92542545 missense probably benign 0.28
R3973:Plod2 UTSW 9 92598619 nonsense probably null
R3974:Plod2 UTSW 9 92598619 nonsense probably null
R4289:Plod2 UTSW 9 92602988 missense possibly damaging 0.89
R4423:Plod2 UTSW 9 92601989 missense probably benign 0.00
R4647:Plod2 UTSW 9 92605450 nonsense probably null
R4754:Plod2 UTSW 9 92606531 nonsense probably null
R4769:Plod2 UTSW 9 92595272 missense probably damaging 1.00
R5279:Plod2 UTSW 9 92581323 missense probably damaging 1.00
R5535:Plod2 UTSW 9 92606569 missense probably damaging 1.00
R5654:Plod2 UTSW 9 92593823 missense probably benign
R5764:Plod2 UTSW 9 92603021 missense probably damaging 0.97
R5885:Plod2 UTSW 9 92606656 critical splice donor site probably null
R5940:Plod2 UTSW 9 92591397 missense probably benign 0.39
R6917:Plod2 UTSW 9 92593770 missense possibly damaging 0.87
R7109:Plod2 UTSW 9 92573597 missense probably damaging 1.00
R7221:Plod2 UTSW 9 92584527 missense probably damaging 1.00
R7311:Plod2 UTSW 9 92584558 missense probably damaging 1.00
R7963:Plod2 UTSW 9 92605446 missense probably benign 0.07
R8205:Plod2 UTSW 9 92542318 start gained probably benign
R8794:Plod2 UTSW 9 92600748 missense probably damaging 0.98
R8873:Plod2 UTSW 9 92607059 intron probably benign
R9044:Plod2 UTSW 9 92607220 missense probably damaging 0.97
R9120:Plod2 UTSW 9 92542327 start gained probably benign
Z1088:Plod2 UTSW 9 92603035 missense probably benign
Predicted Primers PCR Primer
(F):5'- GAAGCCCAGTCCTCTCTTTCAG -3'
(R):5'- ACCCCAAGTCACTAAGGTCTTTC -3'

Sequencing Primer
(F):5'- CAGTTGACACTTAGTGCTATTTTCTG -3'
(R):5'- AAGTCACTAAGGTCTTTCTCCAC -3'
Posted On 2021-11-19