Incidental Mutation 'R9072:Arid5a'
ID 689572
Institutional Source Beutler Lab
Gene Symbol Arid5a
Ensembl Gene ENSMUSG00000037447
Gene Name AT-rich interaction domain 5A
Synonyms D430024K22Rik, Mrf1
MMRRC Submission 068894-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.190) question?
Stock # R9072 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 36346814-36363110 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 36358626 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 401 (E401G)
Ref Sequence ENSEMBL: ENSMUSP00000095385 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097778] [ENSMUST00000115029] [ENSMUST00000115031] [ENSMUST00000115032] [ENSMUST00000116629] [ENSMUST00000126413] [ENSMUST00000137906] [ENSMUST00000142319]
AlphaFold Q3U108
Predicted Effect probably benign
Transcript: ENSMUST00000097778
AA Change: E401G

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000095385
Gene: ENSMUSG00000037447
AA Change: E401G

DomainStartEndE-ValueType
ARID 76 167 4.69e-34 SMART
BRIGHT 80 172 8.63e-31 SMART
low complexity region 453 467 N/A INTRINSIC
low complexity region 512 522 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115029
AA Change: E213G

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000110681
Gene: ENSMUSG00000037447
AA Change: E213G

DomainStartEndE-ValueType
Blast:ARID 1 85 6e-24 BLAST
low complexity region 265 279 N/A INTRINSIC
low complexity region 324 334 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115031
AA Change: E466G

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000110683
Gene: ENSMUSG00000037447
AA Change: E466G

DomainStartEndE-ValueType
ARID 46 232 1.82e-31 SMART
Blast:ARID 281 338 6e-11 BLAST
low complexity region 518 532 N/A INTRINSIC
low complexity region 577 587 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115032
AA Change: E372G

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000110684
Gene: ENSMUSG00000037447
AA Change: E372G

DomainStartEndE-ValueType
ARID 47 138 4.69e-34 SMART
BRIGHT 51 143 8.63e-31 SMART
low complexity region 424 438 N/A INTRINSIC
low complexity region 483 493 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000116629
SMART Domains Protein: ENSMUSP00000136037
Gene: ENSMUSG00000037447

DomainStartEndE-ValueType
Blast:ARID 22 55 8e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000126413
SMART Domains Protein: ENSMUSP00000115490
Gene: ENSMUSG00000037447

DomainStartEndE-ValueType
ARID 46 137 4.69e-34 SMART
BRIGHT 50 142 8.63e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000137906
AA Change: E314G

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000117810
Gene: ENSMUSG00000037447
AA Change: E314G

DomainStartEndE-ValueType
SCOP:d1ig6a_ 41 98 7e-19 SMART
PDB:2OEH|A 42 98 2e-26 PDB
Blast:ARID 42 186 4e-50 BLAST
low complexity region 366 380 N/A INTRINSIC
low complexity region 425 435 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142319
SMART Domains Protein: ENSMUSP00000119953
Gene: ENSMUSG00000037447

DomainStartEndE-ValueType
SCOP:d1kkxa_ 49 81 3e-9 SMART
Blast:ARID 56 121 2e-41 BLAST
PDB:2OEH|A 56 121 2e-9 PDB
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the ARID protein family, including ARID5A, have diverse functions but all appear to play important roles in development, tissue-specific gene expression, and regulation of cell growth (Patsialou et al., 2005 [PubMed 15640446]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced serum interleukin-6 and tumor necrosis factor levels following LPS treatment, and decreased susceptibility to experimental autoimmune encephalomyelitis along with decreased T-helper 17 cell number and increased IFN-gamma producing T cell number. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 T A 6: 86,921,374 (GRCm39) Y190* probably null Het
Agbl3 T C 6: 34,776,387 (GRCm39) C298R probably damaging Het
Ankrd26 T A 6: 118,500,350 (GRCm39) K1040N probably damaging Het
Ano3 T A 2: 110,576,243 (GRCm39) T93S probably benign Het
Apoc3 T A 9: 46,144,532 (GRCm39) I97F probably benign Het
Atxn3 T C 12: 101,903,730 (GRCm39) probably null Het
Brca1 C T 11: 101,393,306 (GRCm39) probably null Het
C1ql3 T A 2: 13,015,198 (GRCm39) N154I probably damaging Het
Ccdc110 A T 8: 46,395,875 (GRCm39) M589L probably benign Het
Ccnb2 A T 9: 70,318,095 (GRCm39) F226I possibly damaging Het
Commd8 TTGTCATCT TT 5: 72,318,327 (GRCm39) probably null Het
Dis3 T C 14: 99,332,647 (GRCm39) T262A probably benign Het
Eif4a2 G A 16: 22,929,403 (GRCm39) R234Q probably benign Het
Ephx2 G A 14: 66,323,688 (GRCm39) R481* probably null Het
Fbxo15 T C 18: 84,983,645 (GRCm39) I331T possibly damaging Het
Gfra2 A G 14: 71,138,935 (GRCm39) E121G possibly damaging Het
Git1 G A 11: 77,389,901 (GRCm39) A55T probably benign Het
Hfm1 T C 5: 107,046,146 (GRCm39) I553V probably benign Het
Hydin G A 8: 110,994,083 (GRCm39) probably null Het
Iqgap3 A G 3: 88,016,773 (GRCm39) N1085S Het
Kbtbd12 T C 6: 88,595,422 (GRCm39) Y136C probably damaging Het
Kcng3 A G 17: 83,938,423 (GRCm39) Y209H possibly damaging Het
Kcnj2 A T 11: 110,962,664 (GRCm39) M19L possibly damaging Het
Lonrf2 A T 1: 38,850,867 (GRCm39) F232I probably damaging Het
Lrrc31 T C 3: 30,753,859 (GRCm39) D14G probably benign Het
Ly6l G A 15: 75,321,585 (GRCm39) V62I possibly damaging Het
Marchf8 T C 6: 116,378,884 (GRCm39) F273L probably benign Het
Masp1 A C 16: 23,288,671 (GRCm39) S710A probably benign Het
Mcm10 G A 2: 5,013,414 (GRCm39) R73C possibly damaging Het
Mcm5 G A 8: 75,852,934 (GRCm39) R682H probably damaging Het
Mink1 C T 11: 70,499,207 (GRCm39) T684I possibly damaging Het
Mocos A T 18: 24,797,089 (GRCm39) Q83L probably damaging Het
Nags T C 11: 102,038,347 (GRCm39) L351P probably damaging Het
Nalcn G A 14: 123,532,863 (GRCm39) T1299I possibly damaging Het
Nlrp4b A G 7: 10,459,870 (GRCm39) D824G probably benign Het
Nwd1 A T 8: 73,422,046 (GRCm39) M1031L probably benign Het
Or11g27 C T 14: 50,771,211 (GRCm39) T114I probably benign Het
Or4c101 A C 2: 88,390,658 (GRCm39) I271L probably benign Het
Or4k40 A T 2: 111,250,705 (GRCm39) I197N possibly damaging Het
Or56b1 C T 7: 104,285,291 (GRCm39) R137C probably benign Het
Or5b112 A G 19: 13,319,238 (GRCm39) T39A possibly damaging Het
Or5d37 T A 2: 87,924,172 (GRCm39) Q36L probably benign Het
Pan2 T C 10: 128,151,050 (GRCm39) M807T probably damaging Het
Parp8 A T 13: 117,047,951 (GRCm39) I222N probably damaging Het
Pmm1 C T 15: 81,839,896 (GRCm39) R143H probably damaging Het
Pou1f1 T C 16: 65,328,833 (GRCm39) L186P Het
Ppargc1b G A 18: 61,443,730 (GRCm39) R494W probably damaging Het
Prg4 G T 1: 150,331,288 (GRCm39) P462T unknown Het
Ptcd1 T A 5: 145,091,525 (GRCm39) I525L probably benign Het
Ptchd4 A T 17: 42,813,650 (GRCm39) Y517F probably damaging Het
Pum1 T C 4: 130,480,172 (GRCm39) F693S probably damaging Het
Ribc2 A C 15: 85,022,163 (GRCm39) Q186P probably damaging Het
Sesn2 C A 4: 132,224,195 (GRCm39) probably null Het
Sgf29 G A 7: 126,271,826 (GRCm39) V284M probably damaging Het
Skap2 C T 6: 51,856,750 (GRCm39) probably null Het
Smap1 T A 1: 23,961,154 (GRCm39) E28V probably damaging Het
Smc3 A G 19: 53,617,200 (GRCm39) N538D probably benign Het
Spen T C 4: 141,203,702 (GRCm39) T1642A unknown Het
Spred3 G A 7: 28,865,955 (GRCm39) R115* probably null Het
Sugt1 T A 14: 79,866,293 (GRCm39) M304K possibly damaging Het
Sval1 T C 6: 41,928,606 (GRCm39) I6T possibly damaging Het
Svil T C 18: 5,097,500 (GRCm39) I1574T probably benign Het
Tinag T A 9: 76,904,300 (GRCm39) probably null Het
Trak1 T C 9: 121,289,554 (GRCm39) L622P probably damaging Het
Ttn C T 2: 76,586,218 (GRCm39) D21838N probably damaging Het
Ttn ATATCTCTCCAGAGCCTCCCCTGGAGGAGTGGAGTATCTCTCCAGAGCCTCCCCTGGAGGAGTGGAGTATCTCTCCAGAGCCTCCCCTG ATATCTCTCCAGAGCCTCCCCTGGAGGAGTGGAGTATCTCTCCAGAGCCTCCCCTG 2: 76,746,150 (GRCm39) probably benign Het
Vmn1r43 G A 6: 89,846,877 (GRCm39) T203M probably damaging Het
Vmn1r73 C T 7: 11,490,203 (GRCm39) A7V probably benign Het
Yy1 G T 12: 108,759,921 (GRCm39) G195C probably benign Het
Zbtb17 T A 4: 141,193,676 (GRCm39) C607S possibly damaging Het
Zfp735 T C 11: 73,603,060 (GRCm39) V668A probably benign Het
Zfp819 C A 7: 43,266,570 (GRCm39) T351K probably damaging Het
Zfp820 C A 17: 22,039,031 (GRCm39) S99I possibly damaging Het
Other mutations in Arid5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01432:Arid5a APN 1 36,358,514 (GRCm39) missense possibly damaging 0.54
IGL02000:Arid5a APN 1 36,358,578 (GRCm39) missense probably damaging 1.00
IGL02322:Arid5a APN 1 36,358,497 (GRCm39) missense probably benign 0.09
PIT4504001:Arid5a UTSW 1 36,356,706 (GRCm39) missense probably damaging 1.00
R0063:Arid5a UTSW 1 36,357,645 (GRCm39) missense probably damaging 1.00
R0063:Arid5a UTSW 1 36,357,645 (GRCm39) missense probably damaging 1.00
R1556:Arid5a UTSW 1 36,359,245 (GRCm39) nonsense probably null
R1703:Arid5a UTSW 1 36,358,656 (GRCm39) splice site probably null
R2424:Arid5a UTSW 1 36,357,582 (GRCm39) missense probably damaging 1.00
R4583:Arid5a UTSW 1 36,356,745 (GRCm39) critical splice donor site probably null
R5725:Arid5a UTSW 1 36,358,211 (GRCm39) nonsense probably null
R6056:Arid5a UTSW 1 36,358,473 (GRCm39) missense probably benign 0.01
R7023:Arid5a UTSW 1 36,356,631 (GRCm39) unclassified probably benign
R7996:Arid5a UTSW 1 36,356,526 (GRCm39) missense unknown
R8739:Arid5a UTSW 1 36,358,677 (GRCm39) missense probably benign 0.02
R9073:Arid5a UTSW 1 36,358,626 (GRCm39) missense probably benign 0.01
R9398:Arid5a UTSW 1 36,358,073 (GRCm39) missense probably benign 0.08
R9583:Arid5a UTSW 1 36,356,739 (GRCm39) missense possibly damaging 0.82
R9679:Arid5a UTSW 1 36,357,648 (GRCm39) missense possibly damaging 0.89
X0020:Arid5a UTSW 1 36,358,656 (GRCm39) splice site probably null
Z1176:Arid5a UTSW 1 36,358,436 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- GCTGAGAACTCTGAACACCAG -3'
(R):5'- AGCGAATCCCTCTTCTTCCAAG -3'

Sequencing Primer
(F):5'- AAGGATTGCAGGCCCCTG -3'
(R):5'- TTACTGCCAAGACCTGGGCTAC -3'
Posted On 2021-11-19