Mutagenetix > Incidental Mutation

Incidental Mutation 'R9072:Agbl3'

689592

Institutional Source

Beutler Lab

Gene Symbol

Agbl3

Ensembl Gene

ENSMUSG00000038836

Gene Name

ATP/GTP binding protein-like 3

Synonyms

4930431N21Rik, 2900053G10Rik, 6530406M24Rik

MMRRC Submission

068894-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9072 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

34780432-34859459 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 34799452 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Arginine at position 298 (C298R)

Ref Sequence

ENSEMBL: ENSMUSP00000110668 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000115016] [ENSMUST00000115017] [ENSMUST00000135304] [ENSMUST00000148834]

AlphaFold

Q8CDP0

Predicted Effect

probably damaging
Transcript: ENSMUST00000115016
AA Change: C298R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000110668
Gene: ENSMUSG00000038836
AA Change: C298R

Domain	Start	End	E-Value	Type
low complexity region	2	25	N/A	INTRINSIC
Pfam:Peptidase_M14	314	563	2.7e-19	PFAM
low complexity region	614	629	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000115017
AA Change: C293R

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000110669
Gene: ENSMUSG00000038836
AA Change: C293R

Domain	Start	End	E-Value	Type
low complexity region	2	25	N/A	INTRINSIC
Pfam:Peptidase_M14	309	560	1e-33	PFAM
low complexity region	609	624	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000135304

SMART Domains

Protein: ENSMUSP00000118303
Gene: ENSMUSG00000038836

Domain	Start	End	E-Value	Type
low complexity region	2	25	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000148834

SMART Domains

Protein: ENSMUSP00000116066
Gene: ENSMUSG00000038836

Domain	Start	End	E-Value	Type
low complexity region	2	25	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygous mice for a targeted allele are viable and fertile. Mice homozygous for a knock-out allele exhibit normal response to herpes simplex virus (HSV) and vaccinia virus (VACV) infection. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aak1	T	A	6: 86,944,392	Y190*	probably null	Het
Ankrd26	T	A	6: 118,523,389	K1040N	probably damaging	Het
Ano3	T	A	2: 110,745,898	T93S	probably benign	Het
Apoc3	T	A	9: 46,233,234	I97F	probably benign	Het
Arid5a	A	G	1: 36,319,545	E401G	probably benign	Het
Atxn3	T	C	12: 101,937,471		probably null	Het
Brca1	C	T	11: 101,502,480		probably null	Het
C1ql3	T	A	2: 13,010,387	N154I	probably damaging	Het
Ccdc110	A	T	8: 45,942,838	M589L	probably benign	Het
Ccnb2	A	T	9: 70,410,813	F226I	possibly damaging	Het
Commd8	TTGTCATCT	TT	5: 72,160,984		probably null	Het
Dis3	T	C	14: 99,095,211	T262A	probably benign	Het
Eif4a2	G	A	16: 23,110,653	R234Q	probably benign	Het
Ephx2	G	A	14: 66,086,239	R481*	probably null	Het
Fbxo15	T	C	18: 84,965,520	I331T	possibly damaging	Het
Gfra2	A	G	14: 70,901,495	E121G	possibly damaging	Het
Git1	G	A	11: 77,499,075	A55T	probably benign	Het
Hfm1	T	C	5: 106,898,280	I553V	probably benign	Het
Hydin	G	A	8: 110,267,451		probably null	Het
Iqgap3	A	G	3: 88,109,466	N1085S		Het
Kbtbd12	T	C	6: 88,618,440	Y136C	probably damaging	Het
Kcng3	A	G	17: 83,630,994	Y209H	possibly damaging	Het
Kcnj2	A	T	11: 111,071,838	M19L	possibly damaging	Het
Lonrf2	A	T	1: 38,811,786	F232I	probably damaging	Het
Lrrc31	T	C	3: 30,699,710	D14G	probably benign	Het
Ly6l	G	A	15: 75,449,736	V62I	possibly damaging	Het
March8	T	C	6: 116,401,923	F273L	probably benign	Het
Masp1	A	C	16: 23,469,921	S710A	probably benign	Het
Mcm10	G	A	2: 5,008,603	R73C	possibly damaging	Het
Mcm5	G	A	8: 75,126,306	R682H	probably damaging	Het
Mink1	C	T	11: 70,608,381	T684I	possibly damaging	Het
Mocos	A	T	18: 24,664,032	Q83L	probably damaging	Het
Nags	T	C	11: 102,147,521	L351P	probably damaging	Het
Nalcn	G	A	14: 123,295,451	T1299I	possibly damaging	Het
Nlrp4b	A	G	7: 10,725,943	D824G	probably benign	Het
Nwd1	A	T	8: 72,695,418	M1031L	probably benign	Het
Olfr1164	T	A	2: 88,093,828	Q36L	probably benign	Het
Olfr1188	A	C	2: 88,560,314	I271L	probably benign	Het
Olfr1286	A	T	2: 111,420,360	I197N	possibly damaging	Het
Olfr1466	A	G	19: 13,341,874	T39A	possibly damaging	Het
Olfr657	C	T	7: 104,636,084	R137C	probably benign	Het
Olfr743	C	T	14: 50,533,754	T114I	probably benign	Het
Pan2	T	C	10: 128,315,181	M807T	probably damaging	Het
Parp8	A	T	13: 116,911,415	I222N	probably damaging	Het
Pmm1	C	T	15: 81,955,695	R143H	probably damaging	Het
Pou1f1	T	C	16: 65,531,947	L186P		Het
Ppargc1b	G	A	18: 61,310,659	R494W	probably damaging	Het
Prg4	G	T	1: 150,455,537	P462T	unknown	Het
Ptcd1	T	A	5: 145,154,715	I525L	probably benign	Het
Ptchd4	A	T	17: 42,502,759	Y517F	probably damaging	Het
Pum1	T	C	4: 130,752,861	F693S	probably damaging	Het
Ribc2	A	C	15: 85,137,962	Q186P	probably damaging	Het
Sesn2	C	A	4: 132,496,884		probably null	Het
Sgf29	G	A	7: 126,672,654	V284M	probably damaging	Het
Skap2	C	T	6: 51,879,770		probably null	Het
Smap1	T	A	1: 23,922,073	E28V	probably damaging	Het
Smc3	A	G	19: 53,628,769	N538D	probably benign	Het
Spen	T	C	4: 141,476,391	T1642A	unknown	Het
Spred3	G	A	7: 29,166,530	R115*	probably null	Het
Sugt1	T	A	14: 79,628,853	M304K	possibly damaging	Het
Sval1	T	C	6: 41,951,672	I6T	possibly damaging	Het
Svil	T	C	18: 5,097,500	I1574T	probably benign	Het
Tinag	T	A	9: 76,997,018		probably null	Het
Trak1	T	C	9: 121,460,488	L622P	probably damaging	Het
Ttn	C	T	2: 76,755,874	D21838N	probably damaging	Het
Ttn	ATATCTCTCCAGAGCCTCCCCTGGAGGAGTGGAGTATCTCTCCAGAGCCTCCCCTGGAGGAGTGGAGTATCTCTCCAGAGCCTCCCCTG	ATATCTCTCCAGAGCCTCCCCTGGAGGAGTGGAGTATCTCTCCAGAGCCTCCCCTG	2: 76,915,806		probably benign	Het
Vmn1r43	G	A	6: 89,869,895	T203M	probably damaging	Het
Vmn1r73	C	T	7: 11,756,276	A7V	probably benign	Het
Yy1	G	T	12: 108,793,995	G195C	probably benign	Het
Zbtb17	T	A	4: 141,466,365	C607S	possibly damaging	Het
Zfp735	T	C	11: 73,712,234	V668A	probably benign	Het
Zfp819	C	A	7: 43,617,146	T351K	probably damaging	Het
Zfp820	C	A	17: 21,820,050	S99I	possibly damaging	Het

Other mutations in Agbl3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00336:Agbl3	APN	6	34846836	missense	probably damaging	1.00
IGL00835:Agbl3	APN	6	34799732	missense	probably damaging	1.00
IGL00840:Agbl3	APN	6	34799159	missense	possibly damaging	0.95
IGL01090:Agbl3	APN	6	34799887	missense	probably benign	0.40
IGL01123:Agbl3	APN	6	34846976	nonsense	probably null
IGL01707:Agbl3	APN	6	34839454	missense	possibly damaging	0.78
IGL01728:Agbl3	APN	6	34782157	start codon destroyed	probably null
IGL02335:Agbl3	APN	6	34799750	missense	probably damaging	1.00
IGL02420:Agbl3	APN	6	34785307	missense	possibly damaging	0.47
IGL02551:Agbl3	APN	6	34823071	missense	possibly damaging	0.88
IGL02974:Agbl3	APN	6	34799822	missense	probably damaging	1.00
IGL03167:Agbl3	APN	6	34857659	missense	possibly damaging	0.92
IGL03182:Agbl3	APN	6	34803500	missense	probably damaging	1.00
R0044:Agbl3	UTSW	6	34799899	missense	probably damaging	1.00
R0499:Agbl3	UTSW	6	34839335	missense	probably benign
R0639:Agbl3	UTSW	6	34799705	missense	probably damaging	1.00
R0850:Agbl3	UTSW	6	34799204	missense	probably damaging	1.00
R1004:Agbl3	UTSW	6	34803451	missense	probably damaging	0.99
R1080:Agbl3	UTSW	6	34828235	missense	probably benign	0.14
R1589:Agbl3	UTSW	6	34857517	missense	possibly damaging	0.77
R2361:Agbl3	UTSW	6	34832505	missense	possibly damaging	0.87
R2495:Agbl3	UTSW	6	34846764	missense	probably damaging	1.00
R3236:Agbl3	UTSW	6	34823087	splice site	probably null
R3237:Agbl3	UTSW	6	34823087	splice site	probably null
R3420:Agbl3	UTSW	6	34793965	missense	probably benign	0.36
R3421:Agbl3	UTSW	6	34793965	missense	probably benign	0.36
R3422:Agbl3	UTSW	6	34793965	missense	probably benign	0.36
R3810:Agbl3	UTSW	6	34799729	missense	probably damaging	1.00
R3811:Agbl3	UTSW	6	34799729	missense	probably damaging	1.00
R4059:Agbl3	UTSW	6	34846899	missense	probably damaging	1.00
R4499:Agbl3	UTSW	6	34857598	missense	probably benign	0.00
R4687:Agbl3	UTSW	6	34798326	missense	probably damaging	1.00
R4854:Agbl3	UTSW	6	34785284	missense	probably damaging	0.97
R5354:Agbl3	UTSW	6	34814752	missense	probably benign	0.03
R5386:Agbl3	UTSW	6	34799196	missense	probably damaging	1.00
R5897:Agbl3	UTSW	6	34803573	missense	probably benign	0.21
R6018:Agbl3	UTSW	6	34799255	missense	probably damaging	1.00
R6148:Agbl3	UTSW	6	34857753	missense	possibly damaging	0.87
R6305:Agbl3	UTSW	6	34782210	missense	unknown
R6525:Agbl3	UTSW	6	34803594	nonsense	probably null
R6546:Agbl3	UTSW	6	34799299	missense	probably damaging	1.00
R6743:Agbl3	UTSW	6	34846953	missense	probably benign	0.03
R6986:Agbl3	UTSW	6	34839452	missense	probably benign	0.42
R7023:Agbl3	UTSW	6	34814769	missense	probably benign	0.02
R7411:Agbl3	UTSW	6	34814819	missense	probably damaging	0.99
R7469:Agbl3	UTSW	6	34814414	missense	probably damaging	1.00
R7631:Agbl3	UTSW	6	34857671	missense	possibly damaging	0.95
R7658:Agbl3	UTSW	6	34832508	missense	probably benign	0.11
R7743:Agbl3	UTSW	6	34846830	missense	probably damaging	1.00
R7801:Agbl3	UTSW	6	34839365	missense	probably benign	0.00
R8033:Agbl3	UTSW	6	34839494	missense	possibly damaging	0.95
R8203:Agbl3	UTSW	6	34799479	missense	probably damaging	1.00
R8769:Agbl3	UTSW	6	34857614	missense	probably damaging	0.96
R9073:Agbl3	UTSW	6	34799452	missense	probably damaging	1.00
R9210:Agbl3	UTSW	6	34798242	missense	probably damaging	0.98
R9255:Agbl3	UTSW	6	34812905	missense	probably damaging	1.00
R9536:Agbl3	UTSW	6	34846926	missense	probably benign
R9560:Agbl3	UTSW	6	34846908	missense	possibly damaging	0.94
R9662:Agbl3	UTSW	6	34832533	nonsense	probably null
RF014:Agbl3	UTSW	6	34799358	missense	possibly damaging	0.53
Z1177:Agbl3	UTSW	6	34799408	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACAATCGGGGTATGAAGCCATTG -3'
(R):5'- TTGGTCTCTCCTGGATGGAC -3'

Sequencing Primer
(F):5'- CATTGTTCTATTCTGAAAAAGAGGCC -3'
(R):5'- GGATGGACCCTTGCAGTCAAAATC -3'

Posted On

2021-11-19