Incidental Mutation 'R9072:Kbtbd12'
ID 689596
Institutional Source Beutler Lab
Gene Symbol Kbtbd12
Ensembl Gene ENSMUSG00000033182
Gene Name kelch repeat and BTB (POZ) domain containing 12
Synonyms 4933428M03Rik, 4833415F11Rik, Klhdc6
MMRRC Submission 068894-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.082) question?
Stock # R9072 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 88521931-88604636 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 88595422 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 136 (Y136C)
Ref Sequence ENSEMBL: ENSMUSP00000112581 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120933] [ENSMUST00000184664] [ENSMUST00000184878]
AlphaFold Q9D618
Predicted Effect probably damaging
Transcript: ENSMUST00000120933
AA Change: Y136C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112581
Gene: ENSMUSG00000033182
AA Change: Y136C

DomainStartEndE-ValueType
BTB 29 126 1.39e-23 SMART
BACK 131 233 6.69e-30 SMART
Kelch 384 434 9.15e-3 SMART
Kelch 435 490 4.3e-8 SMART
Kelch 491 550 1.01e-1 SMART
Kelch 551 601 1.92e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184664
SMART Domains Protein: ENSMUSP00000139069
Gene: ENSMUSG00000033182

DomainStartEndE-ValueType
Pfam:BTB 19 77 6.2e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000184878
SMART Domains Protein: ENSMUSP00000139333
Gene: ENSMUSG00000033182

DomainStartEndE-ValueType
Kelch 30 67 9.94e-1 SMART
Kelch 68 127 1.01e-1 SMART
Kelch 128 178 1.92e0 SMART
Meta Mutation Damage Score 0.1220 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 T A 6: 86,921,374 (GRCm39) Y190* probably null Het
Agbl3 T C 6: 34,776,387 (GRCm39) C298R probably damaging Het
Ankrd26 T A 6: 118,500,350 (GRCm39) K1040N probably damaging Het
Ano3 T A 2: 110,576,243 (GRCm39) T93S probably benign Het
Apoc3 T A 9: 46,144,532 (GRCm39) I97F probably benign Het
Arid5a A G 1: 36,358,626 (GRCm39) E401G probably benign Het
Atxn3 T C 12: 101,903,730 (GRCm39) probably null Het
Brca1 C T 11: 101,393,306 (GRCm39) probably null Het
C1ql3 T A 2: 13,015,198 (GRCm39) N154I probably damaging Het
Ccdc110 A T 8: 46,395,875 (GRCm39) M589L probably benign Het
Ccnb2 A T 9: 70,318,095 (GRCm39) F226I possibly damaging Het
Commd8 TTGTCATCT TT 5: 72,318,327 (GRCm39) probably null Het
Dis3 T C 14: 99,332,647 (GRCm39) T262A probably benign Het
Eif4a2 G A 16: 22,929,403 (GRCm39) R234Q probably benign Het
Ephx2 G A 14: 66,323,688 (GRCm39) R481* probably null Het
Fbxo15 T C 18: 84,983,645 (GRCm39) I331T possibly damaging Het
Gfra2 A G 14: 71,138,935 (GRCm39) E121G possibly damaging Het
Git1 G A 11: 77,389,901 (GRCm39) A55T probably benign Het
Hfm1 T C 5: 107,046,146 (GRCm39) I553V probably benign Het
Hydin G A 8: 110,994,083 (GRCm39) probably null Het
Iqgap3 A G 3: 88,016,773 (GRCm39) N1085S Het
Kcng3 A G 17: 83,938,423 (GRCm39) Y209H possibly damaging Het
Kcnj2 A T 11: 110,962,664 (GRCm39) M19L possibly damaging Het
Lonrf2 A T 1: 38,850,867 (GRCm39) F232I probably damaging Het
Lrrc31 T C 3: 30,753,859 (GRCm39) D14G probably benign Het
Ly6l G A 15: 75,321,585 (GRCm39) V62I possibly damaging Het
Marchf8 T C 6: 116,378,884 (GRCm39) F273L probably benign Het
Masp1 A C 16: 23,288,671 (GRCm39) S710A probably benign Het
Mcm10 G A 2: 5,013,414 (GRCm39) R73C possibly damaging Het
Mcm5 G A 8: 75,852,934 (GRCm39) R682H probably damaging Het
Mink1 C T 11: 70,499,207 (GRCm39) T684I possibly damaging Het
Mocos A T 18: 24,797,089 (GRCm39) Q83L probably damaging Het
Nags T C 11: 102,038,347 (GRCm39) L351P probably damaging Het
Nalcn G A 14: 123,532,863 (GRCm39) T1299I possibly damaging Het
Nlrp4b A G 7: 10,459,870 (GRCm39) D824G probably benign Het
Nwd1 A T 8: 73,422,046 (GRCm39) M1031L probably benign Het
Or11g27 C T 14: 50,771,211 (GRCm39) T114I probably benign Het
Or4c101 A C 2: 88,390,658 (GRCm39) I271L probably benign Het
Or4k40 A T 2: 111,250,705 (GRCm39) I197N possibly damaging Het
Or56b1 C T 7: 104,285,291 (GRCm39) R137C probably benign Het
Or5b112 A G 19: 13,319,238 (GRCm39) T39A possibly damaging Het
Or5d37 T A 2: 87,924,172 (GRCm39) Q36L probably benign Het
Pan2 T C 10: 128,151,050 (GRCm39) M807T probably damaging Het
Parp8 A T 13: 117,047,951 (GRCm39) I222N probably damaging Het
Pmm1 C T 15: 81,839,896 (GRCm39) R143H probably damaging Het
Pou1f1 T C 16: 65,328,833 (GRCm39) L186P Het
Ppargc1b G A 18: 61,443,730 (GRCm39) R494W probably damaging Het
Prg4 G T 1: 150,331,288 (GRCm39) P462T unknown Het
Ptcd1 T A 5: 145,091,525 (GRCm39) I525L probably benign Het
Ptchd4 A T 17: 42,813,650 (GRCm39) Y517F probably damaging Het
Pum1 T C 4: 130,480,172 (GRCm39) F693S probably damaging Het
Ribc2 A C 15: 85,022,163 (GRCm39) Q186P probably damaging Het
Sesn2 C A 4: 132,224,195 (GRCm39) probably null Het
Sgf29 G A 7: 126,271,826 (GRCm39) V284M probably damaging Het
Skap2 C T 6: 51,856,750 (GRCm39) probably null Het
Smap1 T A 1: 23,961,154 (GRCm39) E28V probably damaging Het
Smc3 A G 19: 53,617,200 (GRCm39) N538D probably benign Het
Spen T C 4: 141,203,702 (GRCm39) T1642A unknown Het
Spred3 G A 7: 28,865,955 (GRCm39) R115* probably null Het
Sugt1 T A 14: 79,866,293 (GRCm39) M304K possibly damaging Het
Sval1 T C 6: 41,928,606 (GRCm39) I6T possibly damaging Het
Svil T C 18: 5,097,500 (GRCm39) I1574T probably benign Het
Tinag T A 9: 76,904,300 (GRCm39) probably null Het
Trak1 T C 9: 121,289,554 (GRCm39) L622P probably damaging Het
Ttn C T 2: 76,586,218 (GRCm39) D21838N probably damaging Het
Ttn ATATCTCTCCAGAGCCTCCCCTGGAGGAGTGGAGTATCTCTCCAGAGCCTCCCCTGGAGGAGTGGAGTATCTCTCCAGAGCCTCCCCTG ATATCTCTCCAGAGCCTCCCCTGGAGGAGTGGAGTATCTCTCCAGAGCCTCCCCTG 2: 76,746,150 (GRCm39) probably benign Het
Vmn1r43 G A 6: 89,846,877 (GRCm39) T203M probably damaging Het
Vmn1r73 C T 7: 11,490,203 (GRCm39) A7V probably benign Het
Yy1 G T 12: 108,759,921 (GRCm39) G195C probably benign Het
Zbtb17 T A 4: 141,193,676 (GRCm39) C607S possibly damaging Het
Zfp735 T C 11: 73,603,060 (GRCm39) V668A probably benign Het
Zfp819 C A 7: 43,266,570 (GRCm39) T351K probably damaging Het
Zfp820 C A 17: 22,039,031 (GRCm39) S99I possibly damaging Het
Other mutations in Kbtbd12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01600:Kbtbd12 APN 6 88,595,540 (GRCm39) missense probably benign 0.08
IGL01845:Kbtbd12 APN 6 88,590,922 (GRCm39) missense probably benign 0.16
IGL02447:Kbtbd12 APN 6 88,595,676 (GRCm39) missense probably damaging 1.00
IGL02623:Kbtbd12 APN 6 88,595,371 (GRCm39) missense probably damaging 1.00
IGL02851:Kbtbd12 APN 6 88,595,311 (GRCm39) missense probably benign 0.18
R0334:Kbtbd12 UTSW 6 88,594,888 (GRCm39) missense probably damaging 0.99
R1689:Kbtbd12 UTSW 6 88,595,567 (GRCm39) missense probably damaging 1.00
R1712:Kbtbd12 UTSW 6 88,595,676 (GRCm39) missense probably damaging 1.00
R1777:Kbtbd12 UTSW 6 88,595,042 (GRCm39) missense probably benign 0.00
R2037:Kbtbd12 UTSW 6 88,594,779 (GRCm39) missense probably benign 0.00
R3967:Kbtbd12 UTSW 6 88,595,488 (GRCm39) missense probably benign 0.01
R4660:Kbtbd12 UTSW 6 88,594,772 (GRCm39) missense probably benign 0.44
R4785:Kbtbd12 UTSW 6 88,595,003 (GRCm39) missense probably damaging 1.00
R5224:Kbtbd12 UTSW 6 88,594,681 (GRCm39) intron probably benign
R5568:Kbtbd12 UTSW 6 88,595,609 (GRCm39) missense probably damaging 1.00
R6051:Kbtbd12 UTSW 6 88,594,930 (GRCm39) missense possibly damaging 0.69
R6412:Kbtbd12 UTSW 6 88,595,638 (GRCm39) missense probably damaging 1.00
R6525:Kbtbd12 UTSW 6 88,591,062 (GRCm39) missense probably benign 0.29
R6776:Kbtbd12 UTSW 6 88,595,248 (GRCm39) missense probably damaging 0.97
R7046:Kbtbd12 UTSW 6 88,595,497 (GRCm39) missense possibly damaging 0.89
R7157:Kbtbd12 UTSW 6 88,595,650 (GRCm39) missense probably damaging 1.00
R7224:Kbtbd12 UTSW 6 88,590,965 (GRCm39) nonsense probably null
R7303:Kbtbd12 UTSW 6 88,591,094 (GRCm39) missense unknown
R7650:Kbtbd12 UTSW 6 88,595,530 (GRCm39) missense probably damaging 1.00
R7763:Kbtbd12 UTSW 6 88,595,179 (GRCm39) missense probably benign 0.31
R7982:Kbtbd12 UTSW 6 88,595,616 (GRCm39) missense possibly damaging 0.61
R8103:Kbtbd12 UTSW 6 88,595,663 (GRCm39) missense probably damaging 1.00
R8195:Kbtbd12 UTSW 6 88,594,913 (GRCm39) missense possibly damaging 0.64
R8305:Kbtbd12 UTSW 6 88,595,132 (GRCm39) missense possibly damaging 0.50
R9073:Kbtbd12 UTSW 6 88,595,422 (GRCm39) missense probably damaging 1.00
R9438:Kbtbd12 UTSW 6 88,591,040 (GRCm39) nonsense probably null
R9773:Kbtbd12 UTSW 6 88,524,744 (GRCm39) missense probably damaging 1.00
Z1177:Kbtbd12 UTSW 6 88,595,650 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGCAAAGCTTGGTTATGGTTTAC -3'
(R):5'- ACATCACAGCAGAAAGTGTGTC -3'

Sequencing Primer
(F):5'- TGGTTTACCCATCTCAGAACCAAATC -3'
(R):5'- CTGGAGATCAATAACGCC -3'
Posted On 2021-11-19