Incidental Mutation 'R9072:Trak1'
ID 689613
Institutional Source Beutler Lab
Gene Symbol Trak1
Ensembl Gene ENSMUSG00000032536
Gene Name trafficking protein, kinesin binding 1
Synonyms hyrt, 2310001H13Rik
MMRRC Submission 068894-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.227) question?
Stock # R9072 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 121126568-121303984 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 121289554 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 622 (L622P)
Ref Sequence ENSEMBL: ENSMUSP00000044482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045903] [ENSMUST00000210798] [ENSMUST00000211187] [ENSMUST00000211301] [ENSMUST00000211439]
AlphaFold Q6PD31
Predicted Effect probably damaging
Transcript: ENSMUST00000045903
AA Change: L622P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000044482
Gene: ENSMUSG00000032536
AA Change: L622P

DomainStartEndE-ValueType
Pfam:HAP1_N 47 352 8.1e-139 PFAM
Pfam:Milton 411 580 5e-72 PFAM
low complexity region 882 897 N/A INTRINSIC
Predicted Effect
Predicted Effect possibly damaging
Transcript: ENSMUST00000210798
AA Change: L519P

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect probably damaging
Transcript: ENSMUST00000211187
AA Change: L612P

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect possibly damaging
Transcript: ENSMUST00000211301
AA Change: L519P

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000211439
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice with a spontaneous mutation in this allele have various behavioral abnormalities consistent with hypertonia. Inclusions can be found in neuronal processes of the gray matter of the brainstem and spinal cord. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 T A 6: 86,921,374 (GRCm39) Y190* probably null Het
Agbl3 T C 6: 34,776,387 (GRCm39) C298R probably damaging Het
Ankrd26 T A 6: 118,500,350 (GRCm39) K1040N probably damaging Het
Ano3 T A 2: 110,576,243 (GRCm39) T93S probably benign Het
Apoc3 T A 9: 46,144,532 (GRCm39) I97F probably benign Het
Arid5a A G 1: 36,358,626 (GRCm39) E401G probably benign Het
Atxn3 T C 12: 101,903,730 (GRCm39) probably null Het
Brca1 C T 11: 101,393,306 (GRCm39) probably null Het
C1ql3 T A 2: 13,015,198 (GRCm39) N154I probably damaging Het
Ccdc110 A T 8: 46,395,875 (GRCm39) M589L probably benign Het
Ccnb2 A T 9: 70,318,095 (GRCm39) F226I possibly damaging Het
Commd8 TTGTCATCT TT 5: 72,318,327 (GRCm39) probably null Het
Dis3 T C 14: 99,332,647 (GRCm39) T262A probably benign Het
Eif4a2 G A 16: 22,929,403 (GRCm39) R234Q probably benign Het
Ephx2 G A 14: 66,323,688 (GRCm39) R481* probably null Het
Fbxo15 T C 18: 84,983,645 (GRCm39) I331T possibly damaging Het
Gfra2 A G 14: 71,138,935 (GRCm39) E121G possibly damaging Het
Git1 G A 11: 77,389,901 (GRCm39) A55T probably benign Het
Hfm1 T C 5: 107,046,146 (GRCm39) I553V probably benign Het
Hydin G A 8: 110,994,083 (GRCm39) probably null Het
Iqgap3 A G 3: 88,016,773 (GRCm39) N1085S Het
Kbtbd12 T C 6: 88,595,422 (GRCm39) Y136C probably damaging Het
Kcng3 A G 17: 83,938,423 (GRCm39) Y209H possibly damaging Het
Kcnj2 A T 11: 110,962,664 (GRCm39) M19L possibly damaging Het
Lonrf2 A T 1: 38,850,867 (GRCm39) F232I probably damaging Het
Lrrc31 T C 3: 30,753,859 (GRCm39) D14G probably benign Het
Ly6l G A 15: 75,321,585 (GRCm39) V62I possibly damaging Het
Marchf8 T C 6: 116,378,884 (GRCm39) F273L probably benign Het
Masp1 A C 16: 23,288,671 (GRCm39) S710A probably benign Het
Mcm10 G A 2: 5,013,414 (GRCm39) R73C possibly damaging Het
Mcm5 G A 8: 75,852,934 (GRCm39) R682H probably damaging Het
Mink1 C T 11: 70,499,207 (GRCm39) T684I possibly damaging Het
Mocos A T 18: 24,797,089 (GRCm39) Q83L probably damaging Het
Nags T C 11: 102,038,347 (GRCm39) L351P probably damaging Het
Nalcn G A 14: 123,532,863 (GRCm39) T1299I possibly damaging Het
Nlrp4b A G 7: 10,459,870 (GRCm39) D824G probably benign Het
Nwd1 A T 8: 73,422,046 (GRCm39) M1031L probably benign Het
Or11g27 C T 14: 50,771,211 (GRCm39) T114I probably benign Het
Or4c101 A C 2: 88,390,658 (GRCm39) I271L probably benign Het
Or4k40 A T 2: 111,250,705 (GRCm39) I197N possibly damaging Het
Or56b1 C T 7: 104,285,291 (GRCm39) R137C probably benign Het
Or5b112 A G 19: 13,319,238 (GRCm39) T39A possibly damaging Het
Or5d37 T A 2: 87,924,172 (GRCm39) Q36L probably benign Het
Pan2 T C 10: 128,151,050 (GRCm39) M807T probably damaging Het
Parp8 A T 13: 117,047,951 (GRCm39) I222N probably damaging Het
Pmm1 C T 15: 81,839,896 (GRCm39) R143H probably damaging Het
Pou1f1 T C 16: 65,328,833 (GRCm39) L186P Het
Ppargc1b G A 18: 61,443,730 (GRCm39) R494W probably damaging Het
Prg4 G T 1: 150,331,288 (GRCm39) P462T unknown Het
Ptcd1 T A 5: 145,091,525 (GRCm39) I525L probably benign Het
Ptchd4 A T 17: 42,813,650 (GRCm39) Y517F probably damaging Het
Pum1 T C 4: 130,480,172 (GRCm39) F693S probably damaging Het
Ribc2 A C 15: 85,022,163 (GRCm39) Q186P probably damaging Het
Sesn2 C A 4: 132,224,195 (GRCm39) probably null Het
Sgf29 G A 7: 126,271,826 (GRCm39) V284M probably damaging Het
Skap2 C T 6: 51,856,750 (GRCm39) probably null Het
Smap1 T A 1: 23,961,154 (GRCm39) E28V probably damaging Het
Smc3 A G 19: 53,617,200 (GRCm39) N538D probably benign Het
Spen T C 4: 141,203,702 (GRCm39) T1642A unknown Het
Spred3 G A 7: 28,865,955 (GRCm39) R115* probably null Het
Sugt1 T A 14: 79,866,293 (GRCm39) M304K possibly damaging Het
Sval1 T C 6: 41,928,606 (GRCm39) I6T possibly damaging Het
Svil T C 18: 5,097,500 (GRCm39) I1574T probably benign Het
Tinag T A 9: 76,904,300 (GRCm39) probably null Het
Ttn C T 2: 76,586,218 (GRCm39) D21838N probably damaging Het
Ttn ATATCTCTCCAGAGCCTCCCCTGGAGGAGTGGAGTATCTCTCCAGAGCCTCCCCTGGAGGAGTGGAGTATCTCTCCAGAGCCTCCCCTG ATATCTCTCCAGAGCCTCCCCTGGAGGAGTGGAGTATCTCTCCAGAGCCTCCCCTG 2: 76,746,150 (GRCm39) probably benign Het
Vmn1r43 G A 6: 89,846,877 (GRCm39) T203M probably damaging Het
Vmn1r73 C T 7: 11,490,203 (GRCm39) A7V probably benign Het
Yy1 G T 12: 108,759,921 (GRCm39) G195C probably benign Het
Zbtb17 T A 4: 141,193,676 (GRCm39) C607S possibly damaging Het
Zfp735 T C 11: 73,603,060 (GRCm39) V668A probably benign Het
Zfp819 C A 7: 43,266,570 (GRCm39) T351K probably damaging Het
Zfp820 C A 17: 22,039,031 (GRCm39) S99I possibly damaging Het
Other mutations in Trak1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01308:Trak1 APN 9 121,272,802 (GRCm39) critical splice donor site probably null
IGL01335:Trak1 APN 9 121,283,382 (GRCm39) missense possibly damaging 0.58
IGL01777:Trak1 APN 9 121,260,626 (GRCm39) splice site probably null
IGL01804:Trak1 APN 9 121,271,751 (GRCm39) splice site probably benign
IGL01986:Trak1 APN 9 121,302,033 (GRCm39) missense probably benign 0.00
IGL02248:Trak1 APN 9 121,275,860 (GRCm39) missense probably damaging 1.00
IGL02276:Trak1 APN 9 121,280,734 (GRCm39) missense probably damaging 1.00
IGL02556:Trak1 APN 9 121,277,967 (GRCm39) missense probably damaging 1.00
IGL03368:Trak1 APN 9 121,196,188 (GRCm39) missense possibly damaging 0.66
PIT4468001:Trak1 UTSW 9 121,282,398 (GRCm39) missense probably benign 0.18
R0067:Trak1 UTSW 9 121,301,973 (GRCm39) missense probably damaging 1.00
R0276:Trak1 UTSW 9 121,283,404 (GRCm39) missense probably damaging 0.97
R0535:Trak1 UTSW 9 121,272,778 (GRCm39) missense probably null 1.00
R0629:Trak1 UTSW 9 121,196,233 (GRCm39) missense probably benign 0.37
R0671:Trak1 UTSW 9 121,278,021 (GRCm39) critical splice donor site probably null
R0883:Trak1 UTSW 9 121,282,351 (GRCm39) missense possibly damaging 0.90
R1160:Trak1 UTSW 9 121,221,073 (GRCm39) missense probably benign 0.01
R1162:Trak1 UTSW 9 121,282,407 (GRCm39) missense possibly damaging 0.93
R1168:Trak1 UTSW 9 121,269,745 (GRCm39) missense probably damaging 1.00
R1398:Trak1 UTSW 9 121,283,425 (GRCm39) missense probably damaging 1.00
R2118:Trak1 UTSW 9 121,302,063 (GRCm39) makesense probably null
R2119:Trak1 UTSW 9 121,302,063 (GRCm39) makesense probably null
R2120:Trak1 UTSW 9 121,302,063 (GRCm39) makesense probably null
R2137:Trak1 UTSW 9 121,302,028 (GRCm39) missense possibly damaging 0.83
R3162:Trak1 UTSW 9 121,280,800 (GRCm39) splice site probably benign
R3888:Trak1 UTSW 9 121,271,863 (GRCm39) splice site probably null
R3889:Trak1 UTSW 9 121,274,939 (GRCm39) missense probably null 0.40
R4031:Trak1 UTSW 9 121,280,736 (GRCm39) missense probably damaging 1.00
R4116:Trak1 UTSW 9 121,277,909 (GRCm39) missense probably damaging 1.00
R4406:Trak1 UTSW 9 121,260,602 (GRCm39) missense probably damaging 1.00
R4630:Trak1 UTSW 9 121,283,491 (GRCm39) missense probably benign 0.02
R4631:Trak1 UTSW 9 121,283,491 (GRCm39) missense probably benign 0.02
R4632:Trak1 UTSW 9 121,283,491 (GRCm39) missense probably benign 0.02
R4786:Trak1 UTSW 9 121,301,560 (GRCm39) missense probably benign 0.25
R5137:Trak1 UTSW 9 121,196,121 (GRCm39) intron probably benign
R5159:Trak1 UTSW 9 121,289,478 (GRCm39) missense probably damaging 0.99
R5467:Trak1 UTSW 9 121,275,864 (GRCm39) missense probably damaging 1.00
R5661:Trak1 UTSW 9 121,272,703 (GRCm39) missense possibly damaging 0.46
R5664:Trak1 UTSW 9 121,301,373 (GRCm39) missense possibly damaging 0.47
R5769:Trak1 UTSW 9 121,277,904 (GRCm39) missense probably damaging 1.00
R6041:Trak1 UTSW 9 121,289,478 (GRCm39) missense probably damaging 0.99
R6257:Trak1 UTSW 9 121,196,290 (GRCm39) missense possibly damaging 0.92
R6257:Trak1 UTSW 9 121,275,821 (GRCm39) missense probably damaging 1.00
R6354:Trak1 UTSW 9 121,280,792 (GRCm39) missense probably null 0.03
R6399:Trak1 UTSW 9 121,282,562 (GRCm39) splice site probably null
R6513:Trak1 UTSW 9 121,272,822 (GRCm39) missense probably benign
R6579:Trak1 UTSW 9 121,272,704 (GRCm39) missense probably benign 0.29
R6940:Trak1 UTSW 9 121,272,784 (GRCm39) missense possibly damaging 0.78
R7120:Trak1 UTSW 9 121,289,564 (GRCm39) missense probably benign
R7299:Trak1 UTSW 9 121,280,929 (GRCm39) splice site probably null
R7304:Trak1 UTSW 9 121,245,278 (GRCm39) missense probably benign
R7396:Trak1 UTSW 9 121,277,973 (GRCm39) missense possibly damaging 0.71
R7522:Trak1 UTSW 9 121,271,777 (GRCm39) missense probably damaging 0.99
R7657:Trak1 UTSW 9 121,301,652 (GRCm39) missense probably damaging 1.00
R7733:Trak1 UTSW 9 121,196,291 (GRCm39) missense possibly damaging 0.92
R7793:Trak1 UTSW 9 121,245,264 (GRCm39) nonsense probably null
R7999:Trak1 UTSW 9 121,289,491 (GRCm39) missense probably damaging 1.00
R8209:Trak1 UTSW 9 121,280,793 (GRCm39) missense probably benign
R8215:Trak1 UTSW 9 121,298,096 (GRCm39) missense probably damaging 1.00
R8226:Trak1 UTSW 9 121,280,793 (GRCm39) missense probably benign
R8261:Trak1 UTSW 9 121,280,733 (GRCm39) missense probably damaging 1.00
R8300:Trak1 UTSW 9 121,289,565 (GRCm39) nonsense probably null
R8914:Trak1 UTSW 9 121,272,847 (GRCm39) missense unknown
R9073:Trak1 UTSW 9 121,289,554 (GRCm39) missense probably damaging 1.00
R9312:Trak1 UTSW 9 121,280,757 (GRCm39) missense probably benign 0.01
R9366:Trak1 UTSW 9 121,301,578 (GRCm39) missense probably damaging 1.00
R9663:Trak1 UTSW 9 121,220,924 (GRCm39) missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- AGCTGCCATGCTAACTCTCC -3'
(R):5'- TTTACAGGACTAATCGAGGCGC -3'

Sequencing Primer
(F):5'- ATGCTAACTCTCCCTTCTCTTGG -3'
(R):5'- TGGCGGCTGGTGCATCTC -3'
Posted On 2021-11-19