Mutagenetix > Incidental Mutation

Incidental Mutation 'R9072:Brca1'

689618

Institutional Source

Beutler Lab

Gene Symbol

Brca1

Ensembl Gene

ENSMUSG00000017146

Gene Name

breast cancer 1, early onset

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R9072 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

101488764-101551955 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (1 bp from exon)

DNA Base Change (assembly)

C to T at 101502480 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000017290 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000017290]

AlphaFold

P48754

Predicted Effect

probably null
Transcript: ENSMUST00000017290

SMART Domains

Protein: ENSMUSP00000017290
Gene: ENSMUSG00000017146

Domain	Start	End	E-Value	Type
RING	24	64	1.82e-7	SMART
Pfam:BRCT_assoc	342	503	2.6e-69	PFAM
low complexity region	1173	1185	N/A	INTRINSIC
Blast:BRCT	1343	1406	2e-16	BLAST
low complexity region	1555	1575	N/A	INTRINSIC
BRCT	1587	1669	3.87e-11	SMART
BRCT	1700	1787	3.42e-12	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear phosphoprotein that plays a role in maintaining genomic stability, and it also acts as a tumor suppressor. The encoded protein combines with other tumor suppressors, DNA damage sensors, and signal transducers to form a large multi-subunit protein complex known as the BRCA1-associated genome surveillance complex (BASC). This gene product associates with RNA polymerase II, and through the C-terminal domain, also interacts with histone deacetylase complexes. This protein thus plays a role in transcription, DNA repair of double-stranded breaks, and recombination. Mutations in this gene are responsible for approximately 40% of inherited breast cancers and more than 80% of inherited breast and ovarian cancers. Alternative splicing plays a role in modulating the subcellular localization and physiological function of this gene. Many alternatively spliced transcript variants, some of which are disease-associated mutations, have been described for this gene, but the full-length natures of only some of these variants has been described. A related pseudogene, which is also located on chromosome 17, has been identified. [provided by RefSeq, May 2009]
PHENOTYPE: Homozygous null mutants are embryonic lethal with abnormalities including growth retardation, neural tube defects, and mesoderm abnormalities; conditional mutations cause genetic instability and enhanced tumor formation; mutants with truncated BRCA1 protein survive, have a kinky tail, pigmentation anomalies, male infertility and increased tumor incidence. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aak1	T	A	6: 86,944,392	Y190*	probably null	Het
Agbl3	T	C	6: 34,799,452	C298R	probably damaging	Het
Ankrd26	T	A	6: 118,523,389	K1040N	probably damaging	Het
Ano3	T	A	2: 110,745,898	T93S	probably benign	Het
Apoc3	T	A	9: 46,233,234	I97F	probably benign	Het
Arid5a	A	G	1: 36,319,545	E401G	probably benign	Het
Atxn3	T	C	12: 101,937,471		probably null	Het
C1ql3	T	A	2: 13,010,387	N154I	probably damaging	Het
Ccdc110	A	T	8: 45,942,838	M589L	probably benign	Het
Ccnb2	A	T	9: 70,410,813	F226I	possibly damaging	Het
Commd8	TTGTCATCT	TT	5: 72,160,984		probably null	Het
Dis3	T	C	14: 99,095,211	T262A	probably benign	Het
Eif4a2	G	A	16: 23,110,653	R234Q	probably benign	Het
Ephx2	G	A	14: 66,086,239	R481*	probably null	Het
Fbxo15	T	C	18: 84,965,520	I331T	possibly damaging	Het
Gfra2	A	G	14: 70,901,495	E121G	possibly damaging	Het
Git1	G	A	11: 77,499,075	A55T	probably benign	Het
Hfm1	T	C	5: 106,898,280	I553V	probably benign	Het
Hydin	G	A	8: 110,267,451		probably null	Het
Iqgap3	A	G	3: 88,109,466	N1085S		Het
Kbtbd12	T	C	6: 88,618,440	Y136C	probably damaging	Het
Kcng3	A	G	17: 83,630,994	Y209H	possibly damaging	Het
Kcnj2	A	T	11: 111,071,838	M19L	possibly damaging	Het
Lonrf2	A	T	1: 38,811,786	F232I	probably damaging	Het
Lrrc31	T	C	3: 30,699,710	D14G	probably benign	Het
Ly6l	G	A	15: 75,449,736	V62I	possibly damaging	Het
March8	T	C	6: 116,401,923	F273L	probably benign	Het
Masp1	A	C	16: 23,469,921	S710A	probably benign	Het
Mcm10	G	A	2: 5,008,603	R73C	possibly damaging	Het
Mcm5	G	A	8: 75,126,306	R682H	probably damaging	Het
Mink1	C	T	11: 70,608,381	T684I	possibly damaging	Het
Mocos	A	T	18: 24,664,032	Q83L	probably damaging	Het
Nags	T	C	11: 102,147,521	L351P	probably damaging	Het
Nalcn	G	A	14: 123,295,451	T1299I	possibly damaging	Het
Nlrp4b	A	G	7: 10,725,943	D824G	probably benign	Het
Nwd1	A	T	8: 72,695,418	M1031L	probably benign	Het
Olfr1164	T	A	2: 88,093,828	Q36L	probably benign	Het
Olfr1188	A	C	2: 88,560,314	I271L	probably benign	Het
Olfr1286	A	T	2: 111,420,360	I197N	possibly damaging	Het
Olfr1466	A	G	19: 13,341,874	T39A	possibly damaging	Het
Olfr657	C	T	7: 104,636,084	R137C	probably benign	Het
Olfr743	C	T	14: 50,533,754	T114I	probably benign	Het
Pan2	T	C	10: 128,315,181	M807T	probably damaging	Het
Parp8	A	T	13: 116,911,415	I222N	probably damaging	Het
Pmm1	C	T	15: 81,955,695	R143H	probably damaging	Het
Pou1f1	T	C	16: 65,531,947	L186P		Het
Ppargc1b	G	A	18: 61,310,659	R494W	probably damaging	Het
Prg4	G	T	1: 150,455,537	P462T	unknown	Het
Ptcd1	T	A	5: 145,154,715	I525L	probably benign	Het
Ptchd4	A	T	17: 42,502,759	Y517F	probably damaging	Het
Pum1	T	C	4: 130,752,861	F693S	probably damaging	Het
Ribc2	A	C	15: 85,137,962	Q186P	probably damaging	Het
Sesn2	C	A	4: 132,496,884		probably null	Het
Sgf29	G	A	7: 126,672,654	V284M	probably damaging	Het
Skap2	C	T	6: 51,879,770		probably null	Het
Smap1	T	A	1: 23,922,073	E28V	probably damaging	Het
Smc3	A	G	19: 53,628,769	N538D	probably benign	Het
Spen	T	C	4: 141,476,391	T1642A	unknown	Het
Spred3	G	A	7: 29,166,530	R115*	probably null	Het
Sugt1	T	A	14: 79,628,853	M304K	possibly damaging	Het
Sval1	T	C	6: 41,951,672	I6T	possibly damaging	Het
Svil	T	C	18: 5,097,500	I1574T	probably benign	Het
Tinag	T	A	9: 76,997,018		probably null	Het
Trak1	T	C	9: 121,460,488	L622P	probably damaging	Het
Ttn	C	T	2: 76,755,874	D21838N	probably damaging	Het
Ttn	ATATCTCTCCAGAGCCTCCCCTGGAGGAGTGGAGTATCTCTCCAGAGCCTCCCCTGGAGGAGTGGAGTATCTCTCCAGAGCCTCCCCTG	ATATCTCTCCAGAGCCTCCCCTGGAGGAGTGGAGTATCTCTCCAGAGCCTCCCCTG	2: 76,915,806		probably benign	Het
Vmn1r43	G	A	6: 89,869,895	T203M	probably damaging	Het
Vmn1r73	C	T	7: 11,756,276	A7V	probably benign	Het
Yy1	G	T	12: 108,793,995	G195C	probably benign	Het
Zbtb17	T	A	4: 141,466,365	C607S	possibly damaging	Het
Zfp735	T	C	11: 73,712,234	V668A	probably benign	Het
Zfp819	C	A	7: 43,617,146	T351K	probably damaging	Het
Zfp820	C	A	17: 21,820,050	S99I	possibly damaging	Het

Other mutations in Brca1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01095:Brca1	APN	11	101524369	missense	possibly damaging	0.71
IGL01598:Brca1	APN	11	101524330	missense	probably benign	0.04
IGL01744:Brca1	APN	11	101524176	missense	possibly damaging	0.73
IGL02128:Brca1	APN	11	101530982	unclassified	probably benign
IGL02377:Brca1	APN	11	101524323	missense	probably benign	0.01
IGL02701:Brca1	APN	11	101525235	missense	probably damaging	1.00
IGL02732:Brca1	APN	11	101492219	missense	probably benign	0.07
IGL02935:Brca1	APN	11	101489867	missense	probably benign	0.00
IGL02940:Brca1	APN	11	101489912	missense	probably benign	0.00
IGL03198:Brca1	APN	11	101512711	splice site	probably benign
BB002:Brca1	UTSW	11	101508146	missense	probably benign	0.01
BB009:Brca1	UTSW	11	101540017	missense	possibly damaging	0.85
BB012:Brca1	UTSW	11	101508146	missense	probably benign	0.01
BB019:Brca1	UTSW	11	101540017	missense	possibly damaging	0.85
PIT4142001:Brca1	UTSW	11	101522422	unclassified	probably benign
R0048:Brca1	UTSW	11	101524977	missense	possibly damaging	0.94
R0048:Brca1	UTSW	11	101524977	missense	possibly damaging	0.94
R0109:Brca1	UTSW	11	101531090	missense	possibly damaging	0.85
R0109:Brca1	UTSW	11	101531090	missense	possibly damaging	0.85
R0144:Brca1	UTSW	11	101526121	missense	probably damaging	1.00
R0336:Brca1	UTSW	11	101523993	missense	probably benign	0.04
R0448:Brca1	UTSW	11	101508221	missense	possibly damaging	0.93
R0595:Brca1	UTSW	11	101524887	missense	probably benign	0.27
R0613:Brca1	UTSW	11	101508210	missense	probably benign	0.18
R0863:Brca1	UTSW	11	101524770	missense	probably benign	0.36
R0940:Brca1	UTSW	11	101532143	missense	possibly damaging	0.73
R0962:Brca1	UTSW	11	101525366	missense	possibly damaging	0.46
R1365:Brca1	UTSW	11	101501996	missense	probably benign
R1391:Brca1	UTSW	11	101526546	missense	possibly damaging	0.53
R1467:Brca1	UTSW	11	101531107	unclassified	probably benign
R1484:Brca1	UTSW	11	101529812	missense	possibly damaging	0.86
R1530:Brca1	UTSW	11	101524695	missense	probably damaging	1.00
R1645:Brca1	UTSW	11	101510053	missense	probably benign	0.00
R1682:Brca1	UTSW	11	101525565	missense	probably damaging	0.98
R1687:Brca1	UTSW	11	101489840	missense	probably benign
R1694:Brca1	UTSW	11	101532099	missense	probably damaging	0.98
R1695:Brca1	UTSW	11	101524455	missense	probably damaging	0.97
R1762:Brca1	UTSW	11	101532018	critical splice donor site	probably null
R1868:Brca1	UTSW	11	101498013	missense	probably benign
R1973:Brca1	UTSW	11	101526403	missense	probably benign	0.22
R2034:Brca1	UTSW	11	101489849	missense	probably benign
R2106:Brca1	UTSW	11	101524977	missense	possibly damaging	0.94
R4089:Brca1	UTSW	11	101524176	missense	possibly damaging	0.73
R4194:Brca1	UTSW	11	101525287	missense	probably benign	0.02
R4571:Brca1	UTSW	11	101517366	missense	probably benign	0.00
R4735:Brca1	UTSW	11	101492175	splice site	probably null
R4789:Brca1	UTSW	11	101523932	missense	probably benign	0.00
R4920:Brca1	UTSW	11	101524959	missense	probably damaging	1.00
R4939:Brca1	UTSW	11	101508050	missense	probably benign
R4997:Brca1	UTSW	11	101524333	missense	probably damaging	0.96
R5458:Brca1	UTSW	11	101517285	missense	possibly damaging	0.53
R5778:Brca1	UTSW	11	101525301	missense	possibly damaging	0.47
R6051:Brca1	UTSW	11	101524246	missense	probably damaging	1.00
R6505:Brca1	UTSW	11	101523541	missense	probably benign	0.03
R6548:Brca1	UTSW	11	101524765	missense	probably damaging	1.00
R6971:Brca1	UTSW	11	101534005	missense	probably benign	0.18
R7091:Brca1	UTSW	11	101526427	missense	probably benign	0.00
R7246:Brca1	UTSW	11	101523378	missense	probably benign	0.00
R7417:Brca1	UTSW	11	101524981	missense	probably damaging	1.00
R7861:Brca1	UTSW	11	101526422	missense	possibly damaging	0.87
R7925:Brca1	UTSW	11	101508146	missense	probably benign	0.01
R7932:Brca1	UTSW	11	101540017	missense	possibly damaging	0.85
R8003:Brca1	UTSW	11	101524477	missense	probably benign	0.22
R8046:Brca1	UTSW	11	101525470	missense	probably benign	0.03
R8306:Brca1	UTSW	11	101525637	missense	probably damaging	1.00
R8483:Brca1	UTSW	11	101525976	missense	probably damaging	0.99
R8685:Brca1	UTSW	11	101489846	missense	probably benign	0.19
R9073:Brca1	UTSW	11	101502480	critical splice donor site	probably null
R9486:Brca1	UTSW	11	101523694	missense	probably benign	0.00
R9505:Brca1	UTSW	11	101512766	missense	probably benign	0.00
R9616:Brca1	UTSW	11	101525857	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAGTGGATCTGAACAAAGCGAC -3'
(R):5'- ACACCTGGTTGTCTGTCATC -3'

Sequencing Primer
(F):5'- CACGCACCTAGAGACAAAGCTAG -3'
(R):5'- TCTGTCATCAGAGGTGAATCACC -3'

Posted On

2021-11-19