Incidental Mutation 'R9074:Frmd4a'
ID 689649
Institutional Source Beutler Lab
Gene Symbol Frmd4a
Ensembl Gene ENSMUSG00000026657
Gene Name FERM domain containing 4A
Synonyms Gm13190, 2700017I06Rik, C230040M21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.147) question?
Stock # R9074 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 4017717-4614043 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 4603954 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Tryptophan at position 878 (G878W)
Ref Sequence ENSEMBL: ENSMUSP00000089079 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075767] [ENSMUST00000091497] [ENSMUST00000176828] [ENSMUST00000177457]
AlphaFold Q8BIE6
Predicted Effect probably damaging
Transcript: ENSMUST00000075767
AA Change: G867W

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000075172
Gene: ENSMUSG00000026657
AA Change: G867W

DomainStartEndE-ValueType
B41 1 206 3.24e-40 SMART
FERM_C 210 311 7.69e-27 SMART
Pfam:DUF3338 340 477 1.9e-63 PFAM
low complexity region 558 571 N/A INTRINSIC
low complexity region 610 623 N/A INTRINSIC
low complexity region 732 741 N/A INTRINSIC
low complexity region 764 785 N/A INTRINSIC
low complexity region 790 801 N/A INTRINSIC
low complexity region 924 947 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000091497
AA Change: G878W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000089079
Gene: ENSMUSG00000026657
AA Change: G878W

DomainStartEndE-ValueType
B41 12 217 3.24e-40 SMART
FERM_C 221 322 7.69e-27 SMART
Pfam:DUF3338 352 487 6.3e-61 PFAM
low complexity region 569 582 N/A INTRINSIC
low complexity region 621 634 N/A INTRINSIC
low complexity region 743 752 N/A INTRINSIC
low complexity region 775 796 N/A INTRINSIC
low complexity region 801 812 N/A INTRINSIC
low complexity region 935 958 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000176828
AA Change: G573W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000134803
Gene: ENSMUSG00000026657
AA Change: G573W

DomainStartEndE-ValueType
Pfam:DUF3338 46 183 4.1e-64 PFAM
low complexity region 264 277 N/A INTRINSIC
low complexity region 316 329 N/A INTRINSIC
low complexity region 438 447 N/A INTRINSIC
low complexity region 470 491 N/A INTRINSIC
low complexity region 496 507 N/A INTRINSIC
low complexity region 630 653 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000177457
AA Change: G882W

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000134788
Gene: ENSMUSG00000026657
AA Change: G882W

DomainStartEndE-ValueType
B41 16 221 3.24e-40 SMART
FERM_C 225 326 7.69e-27 SMART
Pfam:DUF3338 355 492 3.9e-63 PFAM
low complexity region 573 586 N/A INTRINSIC
low complexity region 625 638 N/A INTRINSIC
low complexity region 747 756 N/A INTRINSIC
low complexity region 779 800 N/A INTRINSIC
low complexity region 805 816 N/A INTRINSIC
low complexity region 939 962 N/A INTRINSIC
Meta Mutation Damage Score 0.6329 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a FERM domain-containing protein that regulates epithelial cell polarity. It connects ADP ribosylation factor 6 (ARF6) with the Par protein complex, which regulates the remodeling of adherens junctions and linear actin cable formation during epithelial cell polarization. Polymorphisms in this gene are associated with Alzheimer's disease, and also with nicotine dependence. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029P11Rik T A 15: 81,980,810 M84K probably damaging Het
4932415D10Rik T A 10: 82,288,060 S3039C possibly damaging Het
Abcg5 A T 17: 84,664,829 silent Het
Ackr2 T A 9: 121,908,663 C35S probably damaging Het
Adcy8 T A 15: 64,702,091 K1054N probably damaging Het
Adgrf1 A T 17: 43,290,988 probably benign Het
Akap9 T A 5: 4,077,959 I3765K probably benign Het
Brwd1 A T 16: 96,023,410 F1219I Het
Btc A T 5: 91,360,744 probably null Het
Cd163 C T 6: 124,308,988 R166* probably null Het
Cfap52 G A 11: 67,931,830 S405L probably benign Het
Clcn2 A G 16: 20,712,664 L210P possibly damaging Het
Creb3l3 T A 10: 81,088,618 probably null Het
Csn1s2a A T 5: 87,786,599 I144F probably benign Het
Dedd G T 1: 171,340,320 probably benign Het
Eef2k C T 7: 120,891,901 R537C probably damaging Het
Epas1 A T 17: 86,827,839 R633S probably benign Het
Fmn2 C A 1: 174,608,632 T723N unknown Het
Ggcx T G 6: 72,425,941 F294C probably damaging Het
Ghr G A 15: 3,340,988 P132S possibly damaging Het
Gm15446 A T 5: 109,943,433 H517L probably damaging Het
Gm5862 T C 5: 26,021,626 T93A probably damaging Het
Gnb1l T A 16: 18,540,995 I50N probably damaging Het
Greb1l A G 18: 10,532,797 Y897C probably damaging Het
Greb1l T C 18: 10,558,795 C1817R probably damaging Het
Ier5 C A 1: 155,098,529 W301L probably damaging Het
Irf2bp2 A G 8: 126,591,717 L370P probably benign Het
Itga9 T A 9: 118,807,276 N677K probably damaging Het
Itgb7 G T 15: 102,224,362 R172S Het
Kdm6b A T 11: 69,402,151 C1266* probably null Het
Kmt2c A T 5: 25,284,345 V4532E probably damaging Het
Kprp A C 3: 92,824,919 F275V probably damaging Het
Lrrc4 C A 6: 28,831,596 V7L probably damaging Het
Map3k21 G A 8: 125,937,311 R537H probably damaging Het
Mchr1 T G 15: 81,235,779 D2E probably benign Het
Mixl1 T C 1: 180,694,680 D212G probably damaging Het
Mup2 T C 4: 60,139,717 T24A probably benign Het
Naip2 C T 13: 100,154,951 D1160N probably benign Het
Naip2 T C 13: 100,154,960 S1157G probably benign Het
Naip5 T C 13: 100,221,756 K991E possibly damaging Het
Nfe2l1 G A 11: 96,819,747 A552V possibly damaging Het
Olfr1370 C T 13: 21,072,614 R229H possibly damaging Het
Olfr550 T G 7: 102,579,226 S244A probably damaging Het
Olfr657 C T 7: 104,636,084 R137C probably benign Het
Pds5a A G 5: 65,647,136 S527P possibly damaging Het
Peg10 T TCCC 6: 4,756,451 probably benign Het
Pgc T A 17: 47,732,426 V233E probably damaging Het
Pias1 T C 9: 62,980,882 probably benign Het
Pign A T 1: 105,628,521 W72R unknown Het
Pmm1 C T 15: 81,955,695 R143H probably damaging Het
Proc A G 18: 32,135,897 S12P possibly damaging Het
Rida T A 15: 34,488,677 Q23L probably damaging Het
Slc22a8 A G 19: 8,609,661 E406G possibly damaging Het
Slc2a7 A G 4: 150,158,168 T238A probably benign Het
Spp1 A G 5: 104,440,301 I190V probably benign Het
Srgap1 T C 10: 121,792,352 D882G probably damaging Het
Ssrp1 T A 2: 85,045,467 W557R probably damaging Het
Strn C G 17: 78,736,361 A43P probably benign Het
Taf6 A C 5: 138,182,203 Y300D probably damaging Het
Tesk2 A G 4: 116,801,736 Y270C probably damaging Het
Tnnt3 T A 7: 142,512,086 D153E probably benign Het
Ubl7 A G 9: 57,919,354 H117R possibly damaging Het
Vcan T A 13: 89,691,027 T2133S possibly damaging Het
Vrk2 T A 11: 26,593,917 probably benign Het
Wdr72 A C 9: 74,218,620 Q1011P possibly damaging Het
Wls T A 3: 159,909,766 I306N possibly damaging Het
Zfp654 A G 16: 64,791,133 S283P probably damaging Het
Zfp956 C T 6: 47,962,528 T170I possibly damaging Het
Other mutations in Frmd4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Frmd4a APN 2 4594714 missense probably benign 0.00
IGL00508:Frmd4a APN 2 4594734 nonsense probably null
IGL01331:Frmd4a APN 2 4602225 missense probably benign 0.32
IGL01774:Frmd4a APN 2 4535236 splice site probably benign
IGL01909:Frmd4a APN 2 4604033 missense probably benign 0.11
IGL02170:Frmd4a APN 2 4566177 missense probably damaging 0.99
IGL02269:Frmd4a APN 2 4604234 missense probably benign 0.19
IGL02377:Frmd4a APN 2 4534574 missense possibly damaging 0.47
IGL03308:Frmd4a APN 2 4498026 missense possibly damaging 0.95
R0066:Frmd4a UTSW 2 4473152 missense probably damaging 1.00
R0066:Frmd4a UTSW 2 4473152 missense probably damaging 1.00
R0081:Frmd4a UTSW 2 4572441 critical splice donor site probably null
R0128:Frmd4a UTSW 2 4604092 missense probably damaging 0.98
R0130:Frmd4a UTSW 2 4604092 missense probably damaging 0.98
R0376:Frmd4a UTSW 2 4572387 missense probably damaging 0.97
R0529:Frmd4a UTSW 2 4606023 missense probably damaging 1.00
R0549:Frmd4a UTSW 2 4603967 missense possibly damaging 0.76
R1593:Frmd4a UTSW 2 4473188 missense probably damaging 1.00
R1959:Frmd4a UTSW 2 4535186 missense probably damaging 1.00
R2002:Frmd4a UTSW 2 4572365 missense probably damaging 1.00
R2100:Frmd4a UTSW 2 4606023 missense probably damaging 1.00
R2310:Frmd4a UTSW 2 4572399 frame shift probably null
R2340:Frmd4a UTSW 2 4586376 missense probably damaging 1.00
R2426:Frmd4a UTSW 2 4529862 missense probably damaging 1.00
R2680:Frmd4a UTSW 2 4534553 missense probably damaging 1.00
R3409:Frmd4a UTSW 2 4153028 intron probably benign
R3772:Frmd4a UTSW 2 4590622 missense probably damaging 0.99
R3773:Frmd4a UTSW 2 4590622 missense probably damaging 0.99
R3932:Frmd4a UTSW 2 4537260 missense probably damaging 1.00
R4094:Frmd4a UTSW 2 4611032 missense probably damaging 1.00
R4226:Frmd4a UTSW 2 4333078 missense probably benign 0.00
R4299:Frmd4a UTSW 2 4333071 missense probably benign 0.02
R4304:Frmd4a UTSW 2 4333078 missense probably benign 0.00
R4306:Frmd4a UTSW 2 4333078 missense probably benign 0.00
R4307:Frmd4a UTSW 2 4333078 missense probably benign 0.00
R4346:Frmd4a UTSW 2 4608033 missense possibly damaging 0.92
R4360:Frmd4a UTSW 2 4601241 missense probably damaging 1.00
R4384:Frmd4a UTSW 2 4594563 nonsense probably null
R4547:Frmd4a UTSW 2 4473145 missense probably damaging 1.00
R4575:Frmd4a UTSW 2 4603679 missense possibly damaging 0.83
R4577:Frmd4a UTSW 2 4603679 missense possibly damaging 0.83
R4578:Frmd4a UTSW 2 4603679 missense possibly damaging 0.83
R4688:Frmd4a UTSW 2 4537311 missense possibly damaging 0.81
R4764:Frmd4a UTSW 2 4603448 missense probably damaging 1.00
R4826:Frmd4a UTSW 2 4601297 missense probably damaging 1.00
R4879:Frmd4a UTSW 2 4529817 missense probably damaging 1.00
R5053:Frmd4a UTSW 2 4603921 missense probably damaging 1.00
R5392:Frmd4a UTSW 2 4594573 missense probably damaging 1.00
R5733:Frmd4a UTSW 2 4300957 missense possibly damaging 0.53
R5762:Frmd4a UTSW 2 4484065 missense probably damaging 1.00
R5920:Frmd4a UTSW 2 4333116 missense probably benign 0.02
R5932:Frmd4a UTSW 2 4529839 missense probably damaging 1.00
R6117:Frmd4a UTSW 2 4602249 missense possibly damaging 0.66
R6328:Frmd4a UTSW 2 4590698 missense probably damaging 0.99
R6622:Frmd4a UTSW 2 4606062 missense probably benign 0.00
R6903:Frmd4a UTSW 2 4586456 missense probably damaging 1.00
R7065:Frmd4a UTSW 2 4566112
R7098:Frmd4a UTSW 2 4572433 missense probably damaging 1.00
R7258:Frmd4a UTSW 2 4300953 missense probably benign
R7336:Frmd4a UTSW 2 4473214 missense possibly damaging 0.92
R7582:Frmd4a UTSW 2 4594597 frame shift probably null
R7607:Frmd4a UTSW 2 4591936 nonsense probably null
R7697:Frmd4a UTSW 2 4484081 missense probably damaging 1.00
R7750:Frmd4a UTSW 2 4601349 missense probably benign 0.14
R7795:Frmd4a UTSW 2 4590695 missense probably damaging 1.00
R7848:Frmd4a UTSW 2 4591917 intron probably benign
R7899:Frmd4a UTSW 2 4604089 missense probably damaging 1.00
R8024:Frmd4a UTSW 2 4603702 missense probably damaging 1.00
R8399:Frmd4a UTSW 2 4572433 missense probably damaging 1.00
R8778:Frmd4a UTSW 2 4473215 missense probably damaging 1.00
R8876:Frmd4a UTSW 2 4601300 missense probably damaging 0.99
R9075:Frmd4a UTSW 2 4603954 missense probably damaging 1.00
R9076:Frmd4a UTSW 2 4603954 missense probably damaging 1.00
R9105:Frmd4a UTSW 2 4535183 missense probably damaging 0.96
R9213:Frmd4a UTSW 2 4603561 missense probably damaging 1.00
R9227:Frmd4a UTSW 2 4608033 missense possibly damaging 0.92
R9230:Frmd4a UTSW 2 4608033 missense possibly damaging 0.92
R9235:Frmd4a UTSW 2 4594555 missense probably damaging 0.99
R9266:Frmd4a UTSW 2 4606035 missense probably damaging 0.99
R9301:Frmd4a UTSW 2 4153093 missense probably benign 0.27
R9307:Frmd4a UTSW 2 4604233 missense probably benign
R9365:Frmd4a UTSW 2 4602162 missense probably benign 0.01
R9476:Frmd4a UTSW 2 4603513 missense probably benign 0.32
R9484:Frmd4a UTSW 2 4604215 missense possibly damaging 0.49
R9510:Frmd4a UTSW 2 4603513 missense probably benign 0.32
R9513:Frmd4a UTSW 2 4603900 missense probably damaging 0.99
Z1176:Frmd4a UTSW 2 4498021 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCTCAGTACCGCATCAAGG -3'
(R):5'- GTGAAGTCTAGGCAACCTTCAG -3'

Sequencing Primer
(F):5'- GAGTACCCACTATATATCGAGGGC -3'
(R):5'- TTGCACATCTGGGGCATC -3'
Posted On 2021-11-19