Incidental Mutation 'R9074:Clcn2'
ID 689700
Institutional Source Beutler Lab
Gene Symbol Clcn2
Ensembl Gene ENSMUSG00000022843
Gene Name chloride channel, voltage-sensitive 2
Synonyms ClC-2, nmf240, Clc2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.549) question?
Stock # R9074 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 20702964-20717746 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 20712664 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 210 (L210P)
Ref Sequence ENSEMBL: ENSMUSP00000007207 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007207] [ENSMUST00000120099] [ENSMUST00000131522] [ENSMUST00000232309]
AlphaFold Q9R0A1
Predicted Effect possibly damaging
Transcript: ENSMUST00000007207
AA Change: L210P

PolyPhen 2 Score 0.783 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000007207
Gene: ENSMUSG00000022843
AA Change: L210P

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
low complexity region 102 111 N/A INTRINSIC
Pfam:Voltage_CLC 151 555 1.2e-94 PFAM
Blast:CBS 595 644 3e-12 BLAST
low complexity region 666 680 N/A INTRINSIC
CBS 803 850 3.69e0 SMART
low complexity region 869 881 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120099
AA Change: L210P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112759
Gene: ENSMUSG00000022843
AA Change: L210P

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
low complexity region 102 111 N/A INTRINSIC
Pfam:Voltage_CLC 151 538 5.6e-77 PFAM
Blast:CBS 578 627 4e-12 BLAST
low complexity region 649 663 N/A INTRINSIC
CBS 786 833 3.69e0 SMART
low complexity region 852 864 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000131522
AA Change: L210P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122921
Gene: ENSMUSG00000022843
AA Change: L210P

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
low complexity region 102 111 N/A INTRINSIC
Pfam:Voltage_CLC 151 473 4.2e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000231381
Predicted Effect possibly damaging
Transcript: ENSMUST00000232309
AA Change: L166P

PolyPhen 2 Score 0.544 (Sensitivity: 0.88; Specificity: 0.91)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a voltage-gated chloride channel. The encoded protein is a transmembrane protein that maintains chloride ion homeostasis in various cells. Defects in this gene may be a cause of certain epilepsies. Four transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal brain morphology, male infertility, and abnormal eye morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029P11Rik T A 15: 81,980,810 M84K probably damaging Het
4932415D10Rik T A 10: 82,288,060 S3039C possibly damaging Het
Abcg5 A T 17: 84,664,829 silent Het
Ackr2 T A 9: 121,908,663 C35S probably damaging Het
Adcy8 T A 15: 64,702,091 K1054N probably damaging Het
Adgrf1 A T 17: 43,290,988 probably benign Het
Akap9 T A 5: 4,077,959 I3765K probably benign Het
Brwd1 A T 16: 96,023,410 F1219I Het
Btc A T 5: 91,360,744 probably null Het
Cd163 C T 6: 124,308,988 R166* probably null Het
Cfap52 G A 11: 67,931,830 S405L probably benign Het
Creb3l3 T A 10: 81,088,618 probably null Het
Csn1s2a A T 5: 87,786,599 I144F probably benign Het
Dedd G T 1: 171,340,320 probably benign Het
Eef2k C T 7: 120,891,901 R537C probably damaging Het
Epas1 A T 17: 86,827,839 R633S probably benign Het
Fmn2 C A 1: 174,608,632 T723N unknown Het
Frmd4a G T 2: 4,603,954 G878W probably damaging Het
Ggcx T G 6: 72,425,941 F294C probably damaging Het
Ghr G A 15: 3,340,988 P132S possibly damaging Het
Gm15446 A T 5: 109,943,433 H517L probably damaging Het
Gm5862 T C 5: 26,021,626 T93A probably damaging Het
Gnb1l T A 16: 18,540,995 I50N probably damaging Het
Greb1l A G 18: 10,532,797 Y897C probably damaging Het
Greb1l T C 18: 10,558,795 C1817R probably damaging Het
Ier5 C A 1: 155,098,529 W301L probably damaging Het
Irf2bp2 A G 8: 126,591,717 L370P probably benign Het
Itga9 T A 9: 118,807,276 N677K probably damaging Het
Itgb7 G T 15: 102,224,362 R172S Het
Kdm6b A T 11: 69,402,151 C1266* probably null Het
Kmt2c A T 5: 25,284,345 V4532E probably damaging Het
Kprp A C 3: 92,824,919 F275V probably damaging Het
Lrrc4 C A 6: 28,831,596 V7L probably damaging Het
Map3k21 G A 8: 125,937,311 R537H probably damaging Het
Mchr1 T G 15: 81,235,779 D2E probably benign Het
Mixl1 T C 1: 180,694,680 D212G probably damaging Het
Mup2 T C 4: 60,139,717 T24A probably benign Het
Naip2 C T 13: 100,154,951 D1160N probably benign Het
Naip2 T C 13: 100,154,960 S1157G probably benign Het
Naip5 T C 13: 100,221,756 K991E possibly damaging Het
Nfe2l1 G A 11: 96,819,747 A552V possibly damaging Het
Olfr1370 C T 13: 21,072,614 R229H possibly damaging Het
Olfr550 T G 7: 102,579,226 S244A probably damaging Het
Olfr657 C T 7: 104,636,084 R137C probably benign Het
Pds5a A G 5: 65,647,136 S527P possibly damaging Het
Peg10 T TCCC 6: 4,756,451 probably benign Het
Pgc T A 17: 47,732,426 V233E probably damaging Het
Pias1 T C 9: 62,980,882 probably benign Het
Pign A T 1: 105,628,521 W72R unknown Het
Pmm1 C T 15: 81,955,695 R143H probably damaging Het
Proc A G 18: 32,135,897 S12P possibly damaging Het
Rida T A 15: 34,488,677 Q23L probably damaging Het
Slc22a8 A G 19: 8,609,661 E406G possibly damaging Het
Slc2a7 A G 4: 150,158,168 T238A probably benign Het
Spp1 A G 5: 104,440,301 I190V probably benign Het
Srgap1 T C 10: 121,792,352 D882G probably damaging Het
Ssrp1 T A 2: 85,045,467 W557R probably damaging Het
Strn C G 17: 78,736,361 A43P probably benign Het
Taf6 A C 5: 138,182,203 Y300D probably damaging Het
Tesk2 A G 4: 116,801,736 Y270C probably damaging Het
Tnnt3 T A 7: 142,512,086 D153E probably benign Het
Ubl7 A G 9: 57,919,354 H117R possibly damaging Het
Vcan T A 13: 89,691,027 T2133S possibly damaging Het
Vrk2 T A 11: 26,593,917 probably benign Het
Wdr72 A C 9: 74,218,620 Q1011P possibly damaging Het
Wls T A 3: 159,909,766 I306N possibly damaging Het
Zfp654 A G 16: 64,791,133 S283P probably damaging Het
Zfp956 C T 6: 47,962,528 T170I possibly damaging Het
Other mutations in Clcn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00843:Clcn2 APN 16 20703641 missense probably benign 0.08
IGL01657:Clcn2 APN 16 20713619 missense probably damaging 1.00
IGL01797:Clcn2 APN 16 20712761 missense probably damaging 1.00
IGL02557:Clcn2 APN 16 20708464 missense probably damaging 1.00
IGL02624:Clcn2 APN 16 20703348 missense probably damaging 0.98
IGL02819:Clcn2 APN 16 20709256 nonsense probably null
IGL03329:Clcn2 APN 16 20712152 missense probably damaging 1.00
Bemr14 UTSW 16 unclassified
R0008:Clcn2 UTSW 16 20710390 missense probably null 1.00
R0454:Clcn2 UTSW 16 20710428 critical splice acceptor site probably null
R1101:Clcn2 UTSW 16 20703595 missense probably damaging 1.00
R1466:Clcn2 UTSW 16 20712552 splice site probably benign
R1824:Clcn2 UTSW 16 20715962 missense probably benign 0.04
R4592:Clcn2 UTSW 16 20709142 missense probably damaging 0.99
R5011:Clcn2 UTSW 16 20707215 missense probably damaging 1.00
R5013:Clcn2 UTSW 16 20707215 missense probably damaging 1.00
R5154:Clcn2 UTSW 16 20703303 missense probably benign 0.01
R5374:Clcn2 UTSW 16 20709669 missense possibly damaging 0.78
R5726:Clcn2 UTSW 16 20710535 intron probably benign
R5787:Clcn2 UTSW 16 20703433 missense probably damaging 1.00
R5992:Clcn2 UTSW 16 20713654 missense possibly damaging 0.68
R6045:Clcn2 UTSW 16 20711688 critical splice donor site probably null
R6663:Clcn2 UTSW 16 20703245 makesense probably null
R6765:Clcn2 UTSW 16 20707668 splice site probably null
R6825:Clcn2 UTSW 16 20709658 utr 3 prime probably benign
R7872:Clcn2 UTSW 16 20708460 missense probably damaging 0.99
R8028:Clcn2 UTSW 16 20708762 missense possibly damaging 0.66
R8198:Clcn2 UTSW 16 20707196 missense probably damaging 0.99
R8805:Clcn2 UTSW 16 20713418 missense probably damaging 1.00
R8924:Clcn2 UTSW 16 20712180 missense probably damaging 1.00
R8992:Clcn2 UTSW 16 20712330 missense probably damaging 1.00
R9101:Clcn2 UTSW 16 20707229 missense probably benign 0.00
R9456:Clcn2 UTSW 16 20715952 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- AGCTAGCATCTCCGTGTTCC -3'
(R):5'- GGCGTGTGTAATCAGACAATGC -3'

Sequencing Primer
(F):5'- TTCCGGGACTCATGCTGG -3'
(R):5'- GACAATGCTCCTGGGAACATGTATC -3'
Posted On 2021-11-19