Incidental Mutation 'R9074:Pgc'
ID 689704
Institutional Source Beutler Lab
Gene Symbol Pgc
Ensembl Gene ENSMUSG00000023987
Gene Name progastricsin (pepsinogen C)
Synonyms Upg1, 2210410L06Rik, Upg-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock # R9074 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 47726842-47734482 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 47732426 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 233 (V233E)
Ref Sequence ENSEMBL: ENSMUSP00000024782 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024782] [ENSMUST00000086932] [ENSMUST00000144955]
AlphaFold Q9D7R7
Predicted Effect probably damaging
Transcript: ENSMUST00000024782
AA Change: V233E

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000024782
Gene: ENSMUSG00000023987
AA Change: V233E

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:A1_Propeptide 18 46 2.1e-17 PFAM
Pfam:Asp 75 391 6.3e-118 PFAM
Pfam:TAXi_N 76 232 7.2e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000086932
SMART Domains Protein: ENSMUSP00000084151
Gene: ENSMUSG00000023990

DomainStartEndE-ValueType
low complexity region 7 43 N/A INTRINSIC
low complexity region 108 122 N/A INTRINSIC
HLH 240 293 1.44e-15 SMART
Pfam:DUF3371 320 473 7e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144955
SMART Domains Protein: ENSMUSP00000123459
Gene: ENSMUSG00000023987

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:A1_Propeptide 18 46 1.5e-18 PFAM
Pfam:Asp 63 143 1.4e-19 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an aspartic proteinase that belongs to the peptidase family A1. The encoded protein is a digestive enzyme that is produced in the stomach and constitutes a major component of the gastric mucosa. This protein is also secreted into the serum. This protein is synthesized as an inactive zymogen that includes a highly basic prosegment. This enzyme is converted into its active mature form at low pH by sequential cleavage of the prosegment that is carried out by the enzyme itself. Polymorphisms in this gene are associated with susceptibility to gastric cancers. Serum levels of this enzyme are used as a biomarker for certain gastric diseases including Helicobacter pylori related gastritis. Alternate splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome 1. [provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029P11Rik T A 15: 81,980,810 M84K probably damaging Het
4932415D10Rik T A 10: 82,288,060 S3039C possibly damaging Het
Abcg5 A T 17: 84,664,829 silent Het
Ackr2 T A 9: 121,908,663 C35S probably damaging Het
Adcy8 T A 15: 64,702,091 K1054N probably damaging Het
Adgrf1 A T 17: 43,290,988 probably benign Het
Akap9 T A 5: 4,077,959 I3765K probably benign Het
Brwd1 A T 16: 96,023,410 F1219I Het
Btc A T 5: 91,360,744 probably null Het
Cd163 C T 6: 124,308,988 R166* probably null Het
Cfap52 G A 11: 67,931,830 S405L probably benign Het
Clcn2 A G 16: 20,712,664 L210P possibly damaging Het
Creb3l3 T A 10: 81,088,618 probably null Het
Csn1s2a A T 5: 87,786,599 I144F probably benign Het
Dedd G T 1: 171,340,320 probably benign Het
Eef2k C T 7: 120,891,901 R537C probably damaging Het
Epas1 A T 17: 86,827,839 R633S probably benign Het
Fmn2 C A 1: 174,608,632 T723N unknown Het
Frmd4a G T 2: 4,603,954 G878W probably damaging Het
Ggcx T G 6: 72,425,941 F294C probably damaging Het
Ghr G A 15: 3,340,988 P132S possibly damaging Het
Gm15446 A T 5: 109,943,433 H517L probably damaging Het
Gm5862 T C 5: 26,021,626 T93A probably damaging Het
Gnb1l T A 16: 18,540,995 I50N probably damaging Het
Greb1l A G 18: 10,532,797 Y897C probably damaging Het
Greb1l T C 18: 10,558,795 C1817R probably damaging Het
Ier5 C A 1: 155,098,529 W301L probably damaging Het
Irf2bp2 A G 8: 126,591,717 L370P probably benign Het
Itga9 T A 9: 118,807,276 N677K probably damaging Het
Itgb7 G T 15: 102,224,362 R172S Het
Kdm6b A T 11: 69,402,151 C1266* probably null Het
Kmt2c A T 5: 25,284,345 V4532E probably damaging Het
Kprp A C 3: 92,824,919 F275V probably damaging Het
Lrrc4 C A 6: 28,831,596 V7L probably damaging Het
Map3k21 G A 8: 125,937,311 R537H probably damaging Het
Mchr1 T G 15: 81,235,779 D2E probably benign Het
Mixl1 T C 1: 180,694,680 D212G probably damaging Het
Mup2 T C 4: 60,139,717 T24A probably benign Het
Naip2 C T 13: 100,154,951 D1160N probably benign Het
Naip2 T C 13: 100,154,960 S1157G probably benign Het
Naip5 T C 13: 100,221,756 K991E possibly damaging Het
Nfe2l1 G A 11: 96,819,747 A552V possibly damaging Het
Olfr1370 C T 13: 21,072,614 R229H possibly damaging Het
Olfr550 T G 7: 102,579,226 S244A probably damaging Het
Olfr657 C T 7: 104,636,084 R137C probably benign Het
Pds5a A G 5: 65,647,136 S527P possibly damaging Het
Peg10 T TCCC 6: 4,756,451 probably benign Het
Pias1 T C 9: 62,980,882 probably benign Het
Pign A T 1: 105,628,521 W72R unknown Het
Pmm1 C T 15: 81,955,695 R143H probably damaging Het
Proc A G 18: 32,135,897 S12P possibly damaging Het
Rida T A 15: 34,488,677 Q23L probably damaging Het
Slc22a8 A G 19: 8,609,661 E406G possibly damaging Het
Slc2a7 A G 4: 150,158,168 T238A probably benign Het
Spp1 A G 5: 104,440,301 I190V probably benign Het
Srgap1 T C 10: 121,792,352 D882G probably damaging Het
Ssrp1 T A 2: 85,045,467 W557R probably damaging Het
Strn C G 17: 78,736,361 A43P probably benign Het
Taf6 A C 5: 138,182,203 Y300D probably damaging Het
Tesk2 A G 4: 116,801,736 Y270C probably damaging Het
Tnnt3 T A 7: 142,512,086 D153E probably benign Het
Ubl7 A G 9: 57,919,354 H117R possibly damaging Het
Vcan T A 13: 89,691,027 T2133S possibly damaging Het
Vrk2 T A 11: 26,593,917 probably benign Het
Wdr72 A C 9: 74,218,620 Q1011P possibly damaging Het
Wls T A 3: 159,909,766 I306N possibly damaging Het
Zfp654 A G 16: 64,791,133 S283P probably damaging Het
Zfp956 C T 6: 47,962,528 T170I possibly damaging Het
Other mutations in Pgc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01358:Pgc APN 17 47730666 missense probably benign 0.09
IGL01410:Pgc APN 17 47734240 missense probably damaging 0.98
IGL01647:Pgc APN 17 47732404 missense probably damaging 1.00
IGL02141:Pgc APN 17 47726931 missense probably damaging 1.00
IGL02719:Pgc APN 17 47728867 missense probably damaging 0.98
PIT4469001:Pgc UTSW 17 47728755 nonsense probably null
R0736:Pgc UTSW 17 47728780 missense probably damaging 1.00
R1118:Pgc UTSW 17 47728903 critical splice donor site probably null
R1669:Pgc UTSW 17 47733790 missense probably damaging 1.00
R2162:Pgc UTSW 17 47729311 missense probably null 0.96
R3831:Pgc UTSW 17 47729311 missense probably null 0.96
R3833:Pgc UTSW 17 47729311 missense probably null 0.96
R4454:Pgc UTSW 17 47732410 missense probably benign 0.00
R4908:Pgc UTSW 17 47728894 missense probably damaging 0.96
R5544:Pgc UTSW 17 47732504 missense probably benign 0.00
R6829:Pgc UTSW 17 47732781 splice site probably null
R7042:Pgc UTSW 17 47733820 missense probably benign 0.00
R7508:Pgc UTSW 17 47734186 missense probably benign 0.00
R8022:Pgc UTSW 17 47728776 missense probably benign 0.00
R9028:Pgc UTSW 17 47733058 missense possibly damaging 0.51
Z1176:Pgc UTSW 17 47728868 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGCTCCAGTCTAAAGGAAACAC -3'
(R):5'- GACCTATGACTTTGGAGGAGGG -3'

Sequencing Primer
(F):5'- CCAGTCAGAGATACAGAGCGTC -3'
(R):5'- GGTCTCCCACCCACCCTC -3'
Posted On 2021-11-19