Incidental Mutation 'R9074:Greb1l'
ID 689707
Institutional Source Beutler Lab
Gene Symbol Greb1l
Ensembl Gene ENSMUSG00000042942
Gene Name growth regulation by estrogen in breast cancer-like
Synonyms mKIAA4095, AK220484
MMRRC Submission 068895-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9074 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 10325177-10562940 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 10532797 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 897 (Y897C)
Ref Sequence ENSEMBL: ENSMUSP00000049003 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048977] [ENSMUST00000172532] [ENSMUST00000172680]
AlphaFold B9EJV3
Predicted Effect probably damaging
Transcript: ENSMUST00000048977
AA Change: Y897C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000049003
Gene: ENSMUSG00000042942
AA Change: Y897C

DomainStartEndE-ValueType
Pfam:GREB1 1 1172 N/A PFAM
Pfam:GREB1 1154 1913 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000172532
AA Change: Y788C

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000134090
Gene: ENSMUSG00000042942
AA Change: Y788C

DomainStartEndE-ValueType
low complexity region 83 100 N/A INTRINSIC
low complexity region 282 301 N/A INTRINSIC
low complexity region 606 617 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172680
SMART Domains Protein: ENSMUSP00000134314
Gene: ENSMUSG00000042942

DomainStartEndE-ValueType
low complexity region 116 129 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (63/64)
Allele List at MGI

All alleles(5) : Targeted, other(2) Gene trapped(3)

Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg5 A T 17: 84,972,257 (GRCm39) silent Het
Ackr2 T A 9: 121,737,729 (GRCm39) C35S probably damaging Het
Adcy8 T A 15: 64,573,940 (GRCm39) K1054N probably damaging Het
Adgrf1 A T 17: 43,601,879 (GRCm39) probably benign Het
Akap9 T A 5: 4,127,959 (GRCm39) I3765K probably benign Het
Brwd1 A T 16: 95,824,610 (GRCm39) F1219I Het
Btc A T 5: 91,508,603 (GRCm39) probably null Het
Cd163 C T 6: 124,285,947 (GRCm39) R166* probably null Het
Cfap52 G A 11: 67,822,656 (GRCm39) S405L probably benign Het
Clcn2 A G 16: 20,531,414 (GRCm39) L210P possibly damaging Het
Creb3l3 T A 10: 80,924,452 (GRCm39) probably null Het
Csn1s2a A T 5: 87,934,458 (GRCm39) I144F probably benign Het
Dedd G T 1: 171,167,888 (GRCm39) probably benign Het
Eef2k C T 7: 120,491,124 (GRCm39) R537C probably damaging Het
Epas1 A T 17: 87,135,267 (GRCm39) R633S probably benign Het
Fmn2 C A 1: 174,436,198 (GRCm39) T723N unknown Het
Frmd4a G T 2: 4,608,765 (GRCm39) G878W probably damaging Het
Ggcx T G 6: 72,402,924 (GRCm39) F294C probably damaging Het
Ghr G A 15: 3,370,470 (GRCm39) P132S possibly damaging Het
Gm15446 A T 5: 110,091,299 (GRCm39) H517L probably damaging Het
Gm5862 T C 5: 26,226,624 (GRCm39) T93A probably damaging Het
Gnb1l T A 16: 18,359,745 (GRCm39) I50N probably damaging Het
Ier5 C A 1: 154,974,275 (GRCm39) W301L probably damaging Het
Irf2bp2 A G 8: 127,318,456 (GRCm39) L370P probably benign Het
Itga9 T A 9: 118,636,344 (GRCm39) N677K probably damaging Het
Itgb7 G T 15: 102,132,797 (GRCm39) R172S Het
Kdm6b A T 11: 69,292,977 (GRCm39) C1266* probably null Het
Kmt2c A T 5: 25,489,343 (GRCm39) V4532E probably damaging Het
Kprp A C 3: 92,732,226 (GRCm39) F275V probably damaging Het
Lrrc4 C A 6: 28,831,595 (GRCm39) V7L probably damaging Het
Map3k21 G A 8: 126,664,050 (GRCm39) R537H probably damaging Het
Mchr1 T G 15: 81,119,980 (GRCm39) D2E probably benign Het
Mixl1 T C 1: 180,522,245 (GRCm39) D212G probably damaging Het
Mup2 T C 4: 60,139,717 (GRCm39) T24A probably benign Het
Naip2 C T 13: 100,291,459 (GRCm39) D1160N probably benign Het
Naip2 T C 13: 100,291,468 (GRCm39) S1157G probably benign Het
Naip5 T C 13: 100,358,264 (GRCm39) K991E possibly damaging Het
Ndufb11b T A 15: 81,865,011 (GRCm39) M84K probably damaging Het
Nfe2l1 G A 11: 96,710,573 (GRCm39) A552V possibly damaging Het
Or2p2 C T 13: 21,256,784 (GRCm39) R229H possibly damaging Het
Or51r1 T G 7: 102,228,433 (GRCm39) S244A probably damaging Het
Or56b1 C T 7: 104,285,291 (GRCm39) R137C probably benign Het
Pds5a A G 5: 65,804,479 (GRCm39) S527P possibly damaging Het
Peg10 T TCCC 6: 4,756,451 (GRCm39) probably benign Het
Pgc T A 17: 48,043,351 (GRCm39) V233E probably damaging Het
Pias1 T C 9: 62,888,164 (GRCm39) probably benign Het
Pign A T 1: 105,556,246 (GRCm39) W72R unknown Het
Pmm1 C T 15: 81,839,896 (GRCm39) R143H probably damaging Het
Proc A G 18: 32,268,950 (GRCm39) S12P possibly damaging Het
Rida T A 15: 34,488,823 (GRCm39) Q23L probably damaging Het
Slc22a8 A G 19: 8,587,025 (GRCm39) E406G possibly damaging Het
Slc2a7 A G 4: 150,242,625 (GRCm39) T238A probably benign Het
Spata31h1 T A 10: 82,123,894 (GRCm39) S3039C possibly damaging Het
Spp1 A G 5: 104,588,167 (GRCm39) I190V probably benign Het
Srgap1 T C 10: 121,628,257 (GRCm39) D882G probably damaging Het
Ssrp1 T A 2: 84,875,811 (GRCm39) W557R probably damaging Het
Strn C G 17: 79,043,790 (GRCm39) A43P probably benign Het
Taf6 A C 5: 138,180,465 (GRCm39) Y300D probably damaging Het
Tesk2 A G 4: 116,658,933 (GRCm39) Y270C probably damaging Het
Tnnt3 T A 7: 142,065,823 (GRCm39) D153E probably benign Het
Ubl7 A G 9: 57,826,637 (GRCm39) H117R possibly damaging Het
Vcan T A 13: 89,839,146 (GRCm39) T2133S possibly damaging Het
Vrk2 T A 11: 26,543,917 (GRCm39) probably benign Het
Wdr72 A C 9: 74,125,902 (GRCm39) Q1011P possibly damaging Het
Wls T A 3: 159,615,403 (GRCm39) I306N possibly damaging Het
Zfp654 A G 16: 64,611,496 (GRCm39) S283P probably damaging Het
Zfp956 C T 6: 47,939,462 (GRCm39) T170I possibly damaging Het
Other mutations in Greb1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Greb1l APN 18 10,555,962 (GRCm39) missense possibly damaging 0.90
IGL01554:Greb1l APN 18 10,522,144 (GRCm39) missense probably benign 0.01
IGL01563:Greb1l APN 18 10,469,399 (GRCm39) missense probably damaging 0.99
IGL01944:Greb1l APN 18 10,557,280 (GRCm39) missense possibly damaging 0.91
IGL02110:Greb1l APN 18 10,515,271 (GRCm39) missense probably damaging 1.00
IGL02249:Greb1l APN 18 10,532,961 (GRCm39) missense probably damaging 1.00
IGL02318:Greb1l APN 18 10,469,388 (GRCm39) missense possibly damaging 0.91
IGL02340:Greb1l APN 18 10,515,200 (GRCm39) missense probably damaging 0.99
IGL02516:Greb1l APN 18 10,537,064 (GRCm39) missense probably benign 0.31
IGL02566:Greb1l APN 18 10,503,299 (GRCm39) missense probably damaging 0.99
IGL02583:Greb1l APN 18 10,542,362 (GRCm39) missense probably damaging 1.00
IGL02838:Greb1l APN 18 10,560,430 (GRCm39) missense probably damaging 1.00
A4554:Greb1l UTSW 18 10,532,862 (GRCm39) missense possibly damaging 0.58
PIT4453001:Greb1l UTSW 18 10,533,032 (GRCm39) missense probably benign 0.08
PIT4453001:Greb1l UTSW 18 10,533,031 (GRCm39) missense probably damaging 0.98
R0099:Greb1l UTSW 18 10,509,158 (GRCm39) missense probably damaging 1.00
R0226:Greb1l UTSW 18 10,522,076 (GRCm39) intron probably benign
R0234:Greb1l UTSW 18 10,560,331 (GRCm39) missense probably damaging 1.00
R0234:Greb1l UTSW 18 10,560,331 (GRCm39) missense probably damaging 1.00
R0239:Greb1l UTSW 18 10,458,567 (GRCm39) splice site probably benign
R0316:Greb1l UTSW 18 10,547,420 (GRCm39) missense probably damaging 1.00
R0369:Greb1l UTSW 18 10,469,375 (GRCm39) missense possibly damaging 0.80
R0394:Greb1l UTSW 18 10,523,374 (GRCm39) missense probably damaging 0.99
R0478:Greb1l UTSW 18 10,509,281 (GRCm39) missense probably damaging 1.00
R0555:Greb1l UTSW 18 10,458,781 (GRCm39) splice site probably benign
R0671:Greb1l UTSW 18 10,474,303 (GRCm39) missense probably damaging 1.00
R1282:Greb1l UTSW 18 10,547,289 (GRCm39) missense probably benign 0.13
R1574:Greb1l UTSW 18 10,554,997 (GRCm39) missense possibly damaging 0.95
R1574:Greb1l UTSW 18 10,554,997 (GRCm39) missense possibly damaging 0.95
R1607:Greb1l UTSW 18 10,529,703 (GRCm39) missense possibly damaging 0.85
R1666:Greb1l UTSW 18 10,529,708 (GRCm39) critical splice donor site probably null
R1666:Greb1l UTSW 18 10,501,080 (GRCm39) critical splice donor site probably null
R1720:Greb1l UTSW 18 10,553,848 (GRCm39) missense probably benign 0.19
R1808:Greb1l UTSW 18 10,542,143 (GRCm39) missense probably benign
R1829:Greb1l UTSW 18 10,509,314 (GRCm39) missense probably damaging 1.00
R1897:Greb1l UTSW 18 10,498,992 (GRCm39) missense probably benign 0.00
R1967:Greb1l UTSW 18 10,501,049 (GRCm39) missense possibly damaging 0.91
R2025:Greb1l UTSW 18 10,515,221 (GRCm39) missense possibly damaging 0.71
R2086:Greb1l UTSW 18 10,523,281 (GRCm39) missense probably damaging 1.00
R2125:Greb1l UTSW 18 10,511,422 (GRCm39) missense probably damaging 0.98
R2139:Greb1l UTSW 18 10,555,011 (GRCm39) missense probably damaging 1.00
R2255:Greb1l UTSW 18 10,554,857 (GRCm39) missense probably damaging 1.00
R2256:Greb1l UTSW 18 10,503,307 (GRCm39) missense possibly damaging 0.91
R2257:Greb1l UTSW 18 10,503,307 (GRCm39) missense possibly damaging 0.91
R2880:Greb1l UTSW 18 10,547,288 (GRCm39) missense possibly damaging 0.93
R3623:Greb1l UTSW 18 10,542,380 (GRCm39) missense probably damaging 0.99
R3778:Greb1l UTSW 18 10,469,444 (GRCm39) missense possibly damaging 0.60
R3975:Greb1l UTSW 18 10,522,247 (GRCm39) missense possibly damaging 0.71
R4038:Greb1l UTSW 18 10,515,209 (GRCm39) missense possibly damaging 0.93
R4062:Greb1l UTSW 18 10,522,150 (GRCm39) missense probably damaging 0.99
R4134:Greb1l UTSW 18 10,529,708 (GRCm39) critical splice donor site probably null
R4342:Greb1l UTSW 18 10,544,561 (GRCm39) missense probably benign 0.12
R4409:Greb1l UTSW 18 10,503,182 (GRCm39) missense possibly damaging 0.70
R4600:Greb1l UTSW 18 10,553,705 (GRCm39) missense probably damaging 1.00
R4618:Greb1l UTSW 18 10,498,965 (GRCm39) missense probably benign 0.00
R4683:Greb1l UTSW 18 10,529,563 (GRCm39) splice site probably null
R4686:Greb1l UTSW 18 10,522,112 (GRCm39) missense probably damaging 0.98
R4707:Greb1l UTSW 18 10,532,922 (GRCm39) missense probably benign 0.02
R4780:Greb1l UTSW 18 10,541,792 (GRCm39) missense probably benign 0.00
R4819:Greb1l UTSW 18 10,458,358 (GRCm39) missense probably damaging 1.00
R4925:Greb1l UTSW 18 10,547,447 (GRCm39) missense possibly damaging 0.79
R4960:Greb1l UTSW 18 10,547,306 (GRCm39) missense probably damaging 0.99
R5150:Greb1l UTSW 18 10,555,950 (GRCm39) frame shift probably null
R5154:Greb1l UTSW 18 10,458,312 (GRCm39) missense probably benign 0.02
R5269:Greb1l UTSW 18 10,511,409 (GRCm39) missense probably benign
R5290:Greb1l UTSW 18 10,542,427 (GRCm39) missense probably damaging 1.00
R5310:Greb1l UTSW 18 10,542,427 (GRCm39) missense probably damaging 1.00
R5328:Greb1l UTSW 18 10,553,720 (GRCm39) missense probably damaging 1.00
R5337:Greb1l UTSW 18 10,509,143 (GRCm39) missense probably damaging 1.00
R5393:Greb1l UTSW 18 10,458,312 (GRCm39) missense probably benign 0.02
R5402:Greb1l UTSW 18 10,537,169 (GRCm39) missense probably benign 0.26
R5718:Greb1l UTSW 18 10,542,427 (GRCm39) missense probably damaging 1.00
R5719:Greb1l UTSW 18 10,542,427 (GRCm39) missense probably damaging 1.00
R5720:Greb1l UTSW 18 10,542,427 (GRCm39) missense probably damaging 1.00
R5721:Greb1l UTSW 18 10,542,427 (GRCm39) missense probably damaging 1.00
R5902:Greb1l UTSW 18 10,538,302 (GRCm39) missense probably benign 0.00
R5993:Greb1l UTSW 18 10,544,455 (GRCm39) missense probably benign 0.10
R6035:Greb1l UTSW 18 10,501,025 (GRCm39) missense possibly damaging 0.91
R6035:Greb1l UTSW 18 10,501,025 (GRCm39) missense possibly damaging 0.91
R6045:Greb1l UTSW 18 10,547,068 (GRCm39) missense probably damaging 1.00
R6063:Greb1l UTSW 18 10,557,340 (GRCm39) missense probably damaging 1.00
R6297:Greb1l UTSW 18 10,469,494 (GRCm39) missense probably damaging 1.00
R6405:Greb1l UTSW 18 10,501,076 (GRCm39) missense probably benign 0.30
R6552:Greb1l UTSW 18 10,541,814 (GRCm39) missense probably benign 0.00
R6572:Greb1l UTSW 18 10,522,131 (GRCm39) missense probably benign 0.07
R6575:Greb1l UTSW 18 10,547,347 (GRCm39) missense possibly damaging 0.88
R6922:Greb1l UTSW 18 10,547,482 (GRCm39) missense possibly damaging 0.88
R6957:Greb1l UTSW 18 10,558,786 (GRCm39) missense probably benign 0.23
R6962:Greb1l UTSW 18 10,547,327 (GRCm39) missense probably damaging 1.00
R7012:Greb1l UTSW 18 10,529,707 (GRCm39) critical splice donor site probably null
R7179:Greb1l UTSW 18 10,544,576 (GRCm39) missense probably benign 0.00
R7251:Greb1l UTSW 18 10,515,319 (GRCm39) missense probably damaging 1.00
R7275:Greb1l UTSW 18 10,544,561 (GRCm39) missense probably benign 0.12
R7301:Greb1l UTSW 18 10,544,970 (GRCm39) missense probably damaging 1.00
R7307:Greb1l UTSW 18 10,538,142 (GRCm39) missense probably damaging 0.99
R7455:Greb1l UTSW 18 10,554,915 (GRCm39) missense probably damaging 1.00
R7832:Greb1l UTSW 18 10,542,056 (GRCm39) missense probably benign 0.38
R7934:Greb1l UTSW 18 10,474,371 (GRCm39) nonsense probably null
R8137:Greb1l UTSW 18 10,474,357 (GRCm39) missense possibly damaging 0.77
R8138:Greb1l UTSW 18 10,533,060 (GRCm39) missense probably benign 0.13
R8208:Greb1l UTSW 18 10,510,703 (GRCm39) missense probably damaging 1.00
R8227:Greb1l UTSW 18 10,515,371 (GRCm39) missense probably damaging 1.00
R8312:Greb1l UTSW 18 10,511,587 (GRCm39) intron probably benign
R8331:Greb1l UTSW 18 10,458,706 (GRCm39) missense possibly damaging 0.96
R8364:Greb1l UTSW 18 10,529,687 (GRCm39) missense possibly damaging 0.85
R8389:Greb1l UTSW 18 10,529,613 (GRCm39) missense probably benign 0.00
R8695:Greb1l UTSW 18 10,544,450 (GRCm39) missense probably benign 0.01
R8795:Greb1l UTSW 18 10,553,739 (GRCm39) missense probably damaging 0.98
R8836:Greb1l UTSW 18 10,509,257 (GRCm39) missense probably benign 0.30
R8862:Greb1l UTSW 18 10,555,042 (GRCm39) missense possibly damaging 0.90
R8872:Greb1l UTSW 18 10,529,684 (GRCm39) missense probably benign 0.18
R8874:Greb1l UTSW 18 10,544,896 (GRCm39) missense probably benign 0.01
R8886:Greb1l UTSW 18 10,553,843 (GRCm39) missense probably benign 0.21
R8921:Greb1l UTSW 18 10,541,825 (GRCm39) missense probably benign 0.01
R8997:Greb1l UTSW 18 10,510,747 (GRCm39) missense probably damaging 1.00
R9015:Greb1l UTSW 18 10,541,675 (GRCm39) missense probably benign 0.00
R9018:Greb1l UTSW 18 10,542,004 (GRCm39) missense possibly damaging 0.76
R9074:Greb1l UTSW 18 10,558,795 (GRCm39) missense probably damaging 1.00
R9117:Greb1l UTSW 18 10,542,422 (GRCm39) missense probably benign 0.31
R9189:Greb1l UTSW 18 10,499,983 (GRCm39) missense probably benign
R9332:Greb1l UTSW 18 10,532,796 (GRCm39) missense possibly damaging 0.92
R9367:Greb1l UTSW 18 10,522,130 (GRCm39) missense probably benign 0.00
R9497:Greb1l UTSW 18 10,458,600 (GRCm39) missense probably benign 0.00
R9796:Greb1l UTSW 18 10,538,233 (GRCm39) missense possibly damaging 0.69
Z1176:Greb1l UTSW 18 10,515,305 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTAGCATGACTAGGCCAG -3'
(R):5'- GAAGGCACTCTGATGACGAG -3'

Sequencing Primer
(F):5'- ATGACTAGGCCAGCCCTC -3'
(R):5'- CACTCTGATGACGAGCATGTGTC -3'
Posted On 2021-11-19