Incidental Mutation 'R9075:Cdh4'
ID 689718
Institutional Source Beutler Lab
Gene Symbol Cdh4
Ensembl Gene ENSMUSG00000000305
Gene Name cadherin 4
Synonyms R-Cadh, Rcad, R-cadherin
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9075 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 179442431-179899373 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 179860147 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 300 (D300G)
Ref Sequence ENSEMBL: ENSMUSP00000000314 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000314]
AlphaFold P39038
Predicted Effect probably damaging
Transcript: ENSMUST00000000314
AA Change: D300G

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000000314
Gene: ENSMUSG00000000305
AA Change: D300G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Cadherin_pro 30 121 1.18e-30 SMART
CA 187 272 2.31e-15 SMART
CA 296 387 4.33e-29 SMART
CA 410 503 2.21e-12 SMART
CA 526 610 7.16e-21 SMART
CA 630 715 3.78e-2 SMART
transmembrane domain 730 752 N/A INTRINSIC
Pfam:Cadherin_C 760 909 2.5e-52 PFAM
Meta Mutation Damage Score 0.9433 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of calcium-dependent glycoproteins that mediate cell adhesion and regulate many morphogenetic events during development. The encoded preproprotein is further processed to generate a mature protein. The encoded protein is involved in retinal angiogenesis during development where it plays a crucial role in the endothelial-astrocyte interactions. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous mutation of this gene results in dilation of the proximal renal tubules and extensive vacuolization of tubule epithelium. Uretic bud epithelium appear disorganized and exhibit increased apoptosis at E15.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110009E18Rik T G 1: 120,169,284 S137A Het
Actl6a G T 3: 32,715,492 C152F possibly damaging Het
Adam26b A T 8: 43,520,368 D532E probably benign Het
Adamts6 A G 13: 104,462,285 N878S probably benign Het
Ap1b1 T C 11: 5,025,597 S387P possibly damaging Het
Cdh23 A G 10: 60,317,762 S2350P probably damaging Het
Cngb1 T C 8: 95,253,365 Y969C probably damaging Het
Cog8 C T 8: 107,052,576 M356I probably damaging Het
Fam168a T A 7: 100,835,375 V224D probably damaging Het
Fam210a C T 18: 68,272,622 V177M probably damaging Het
Flnc A T 6: 29,447,647 I1150F probably damaging Het
Frmd4a G T 2: 4,603,954 G878W probably damaging Het
Gm11555 C T 11: 99,649,868 C95Y Het
Gns A G 10: 121,390,637 N397S probably benign Het
Grin2b CA C 6: 135,732,511 probably null Het
Ifi204 T A 1: 173,761,716 N50Y possibly damaging Het
Iqub T A 6: 24,446,125 I767F probably damaging Het
Lama2 A T 10: 26,981,592 L3087Q probably damaging Het
Mars2 A G 1: 55,238,995 T586A probably damaging Het
Mrps28 G T 3: 8,802,252 S185R probably benign Het
Nphp4 T C 4: 152,507,448 Y363H probably damaging Het
Nploc4 T C 11: 120,413,700 T232A possibly damaging Het
Pate3 A G 9: 35,646,597 probably null Het
Pcdh18 G A 3: 49,744,890 A1041V probably benign Het
Plpp5 T A 8: 25,720,352 Y50N probably benign Het
Ppp4r4 G T 12: 103,604,031 G755* probably null Het
Psmd14 T A 2: 61,776,677 V156D probably damaging Het
Ptch1 G A 13: 63,533,521 R651C possibly damaging Het
Rai14 T C 15: 10,589,317 E265G probably damaging Het
Rbmx G A X: 57,387,357 P301L probably benign Het
Rimbp2 T A 5: 128,774,248 D878V probably damaging Het
Sarm1 T C 11: 78,483,197 K668R probably benign Het
Slc10a2 C A 8: 5,105,267 probably benign Het
Slc15a3 T C 19: 10,848,730 S262P probably damaging Het
Slf2 T C 19: 44,942,421 Y646H probably damaging Het
Smpd4 C T 16: 17,639,985 P406S unknown Het
Sv2b A G 7: 75,140,097 V396A possibly damaging Het
Swt1 A G 1: 151,370,494 probably benign Het
Sympk A G 7: 19,042,638 E485G probably benign Het
Tbc1d9 T C 8: 83,255,872 V762A probably benign Het
Thbs2 T A 17: 14,680,325 H540L probably benign Het
Tie1 C A 4: 118,484,159 G275V possibly damaging Het
Tmprss15 T C 16: 78,957,371 Y998C probably damaging Het
Trappc10 A T 10: 78,204,296 V607E possibly damaging Het
Trim69 A T 2: 122,178,783 R441S probably benign Het
Trio G T 15: 27,773,936 S1814* probably null Het
Vmn1r192 C T 13: 22,187,163 V296I probably benign Het
Vmn1r223 A G 13: 23,249,430 S65G possibly damaging Het
Vmn1r43 G A 6: 89,869,895 T203M probably damaging Het
Vmn2r41 A G 7: 8,138,251 V738A probably benign Het
Zfp408 A G 2: 91,645,720 V363A possibly damaging Het
Zfp583 A T 7: 6,316,871 C381S probably damaging Het
Other mutations in Cdh4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01149:Cdh4 APN 2 179874144 missense probably damaging 1.00
IGL01411:Cdh4 APN 2 179780403 missense probably damaging 0.96
IGL01752:Cdh4 APN 2 179890884 missense probably damaging 1.00
IGL02814:Cdh4 APN 2 179780474 missense probably benign 0.01
R0082:Cdh4 UTSW 2 179894188 missense possibly damaging 0.75
R0357:Cdh4 UTSW 2 179847340 missense probably damaging 1.00
R1521:Cdh4 UTSW 2 179797558 missense probably damaging 1.00
R1591:Cdh4 UTSW 2 179886864 critical splice donor site probably null
R1622:Cdh4 UTSW 2 179889092 missense possibly damaging 0.56
R1762:Cdh4 UTSW 2 179797480 missense probably benign 0.01
R1794:Cdh4 UTSW 2 179886842 missense probably damaging 1.00
R2275:Cdh4 UTSW 2 179890847 missense probably damaging 1.00
R2277:Cdh4 UTSW 2 179797524 missense possibly damaging 0.88
R3686:Cdh4 UTSW 2 179780367 missense probably benign 0.09
R3861:Cdh4 UTSW 2 179874097 missense probably damaging 1.00
R4078:Cdh4 UTSW 2 179889173 missense possibly damaging 0.93
R4495:Cdh4 UTSW 2 179780389 missense probably damaging 0.98
R4715:Cdh4 UTSW 2 179780467 missense probably benign 0.03
R4893:Cdh4 UTSW 2 179847419 intron probably benign
R5029:Cdh4 UTSW 2 179881949 missense possibly damaging 0.93
R5363:Cdh4 UTSW 2 179886763 missense probably benign
R5542:Cdh4 UTSW 2 179860226 missense probably damaging 0.98
R5773:Cdh4 UTSW 2 179885996 missense probably damaging 1.00
R5791:Cdh4 UTSW 2 179895767 missense probably damaging 1.00
R6262:Cdh4 UTSW 2 179797626 missense probably damaging 1.00
R6338:Cdh4 UTSW 2 179890812 missense probably damaging 1.00
R6589:Cdh4 UTSW 2 179881996 critical splice donor site probably null
R6607:Cdh4 UTSW 2 179874096 missense probably benign 0.00
R6653:Cdh4 UTSW 2 179780428 missense probably benign 0.34
R6711:Cdh4 UTSW 2 179890931 missense probably damaging 1.00
R6744:Cdh4 UTSW 2 179847387 missense possibly damaging 0.68
R6824:Cdh4 UTSW 2 179797558 missense probably damaging 1.00
R6901:Cdh4 UTSW 2 179860194 missense probably benign 0.19
R6981:Cdh4 UTSW 2 179797504 missense probably benign 0.28
R7285:Cdh4 UTSW 2 179797465 missense probably benign 0.00
R7514:Cdh4 UTSW 2 179890843 missense possibly damaging 0.91
R7541:Cdh4 UTSW 2 179444810 splice site probably null
R7560:Cdh4 UTSW 2 179890902 missense probably benign 0.25
R8146:Cdh4 UTSW 2 179874078 missense possibly damaging 0.91
R8833:Cdh4 UTSW 2 179894035 missense possibly damaging 0.61
R9203:Cdh4 UTSW 2 179780403 missense probably damaging 0.96
Z1177:Cdh4 UTSW 2 179780326 missense probably benign 0.45
Predicted Primers PCR Primer
(F):5'- AAAACTCCCTCAGGTGCAG -3'
(R):5'- CTGGATCCCTAACCATGTGTCC -3'

Sequencing Primer
(F):5'- TCAGGTGCAGGCTGAGG -3'
(R):5'- GTCCCTTTGGATCACAGAGCTAG -3'
Posted On 2021-11-19