Incidental Mutation 'R9076:Zc3h6'
ID 689774
Institutional Source Beutler Lab
Gene Symbol Zc3h6
Ensembl Gene ENSMUSG00000042851
Gene Name zinc finger CCCH type containing 6
Synonyms 4631426G04Rik, 4833425H18Rik
MMRRC Submission 068897-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.197) question?
Stock # R9076 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 128809322-128860483 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to G at 128859096 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 1042 (Y1042*)
Ref Sequence ENSEMBL: ENSMUSP00000105949 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110320]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000110320
AA Change: Y1042*
SMART Domains Protein: ENSMUSP00000105949
Gene: ENSMUSG00000042851
AA Change: Y1042*

DomainStartEndE-ValueType
low complexity region 8 25 N/A INTRINSIC
coiled coil region 30 71 N/A INTRINSIC
low complexity region 74 88 N/A INTRINSIC
low complexity region 177 192 N/A INTRINSIC
ZnF_C3H1 271 296 1.72e-4 SMART
ZnF_C3H1 300 325 2.51e-6 SMART
ZnF_C3H1 326 349 5.24e0 SMART
coiled coil region 351 383 N/A INTRINSIC
low complexity region 385 400 N/A INTRINSIC
low complexity region 493 509 N/A INTRINSIC
low complexity region 698 707 N/A INTRINSIC
low complexity region 784 798 N/A INTRINSIC
low complexity region 815 829 N/A INTRINSIC
low complexity region 876 890 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 99% (67/68)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy7 G A 8: 89,054,336 (GRCm39) G1064R probably damaging Het
Adcy9 A G 16: 4,106,687 (GRCm39) V1046A probably damaging Het
Adgrv1 C T 13: 81,570,247 (GRCm39) probably null Het
Apbb2 A C 5: 66,469,507 (GRCm39) L554W probably damaging Het
Arhgef10 C T 8: 15,024,993 (GRCm39) P722S probably damaging Het
B3galt9 A T 2: 34,729,209 (GRCm39) Y336F probably damaging Het
Capns1 A C 7: 29,893,510 (GRCm39) M1R probably null Het
Chst1 C T 2: 92,443,761 (GRCm39) Q78* probably null Het
Clec12b A G 6: 129,356,580 (GRCm39) S195P possibly damaging Het
Cog8 C T 8: 107,779,208 (GRCm39) M356I probably damaging Het
Cyp4b1 T C 4: 115,482,424 (GRCm39) N452D probably damaging Het
Defb40 A T 8: 19,024,994 (GRCm39) Y71N probably benign Het
Dhx8 G T 11: 101,629,021 (GRCm39) R190L Het
Disp1 G A 1: 182,868,799 (GRCm39) T1207M possibly damaging Het
Dnah9 T A 11: 66,008,464 (GRCm39) Y787F probably benign Het
Egflam T C 15: 7,237,155 (GRCm39) N1010D probably damaging Het
Fam151a T A 4: 106,603,254 (GRCm39) Y272N probably damaging Het
Fat1 T C 8: 45,492,938 (GRCm39) Y3887H probably damaging Het
Fpr3 T A 17: 18,191,725 (GRCm39) I332N probably benign Het
Frmd4a G T 2: 4,608,765 (GRCm39) G878W probably damaging Het
Fv1 T C 4: 147,953,628 (GRCm39) Y65H possibly damaging Het
Gabra6 G A 11: 42,198,289 (GRCm39) A387V probably benign Het
Gna11 T C 10: 81,366,715 (GRCm39) T332A Het
Gpr161 T A 1: 165,133,757 (GRCm39) H6Q possibly damaging Het
Grin2b CA C 6: 135,709,509 (GRCm39) probably null Het
Heatr3 A T 8: 88,876,827 (GRCm39) M290L probably benign Het
Ifi47 T G 11: 48,986,842 (GRCm39) I203R probably benign Het
Ighv5-8 TATACAT TAT 12: 113,618,583 (GRCm39) probably benign Het
Klhl10 A G 11: 100,337,962 (GRCm39) M234V possibly damaging Het
Klra4 A G 6: 130,039,107 (GRCm39) I95T possibly damaging Het
Krt84 A G 15: 101,438,098 (GRCm39) F286L probably damaging Het
Lrp2 A G 2: 69,350,260 (GRCm39) V704A probably benign Het
Lypd6b A T 2: 49,837,534 (GRCm39) S169C possibly damaging Het
Mapk12 T C 15: 89,024,611 (GRCm39) E22G probably benign Het
Ncapg T C 5: 45,833,983 (GRCm39) C340R probably benign Het
Ncor2 A G 5: 125,111,086 (GRCm39) L394P Het
Nek1 T G 8: 61,481,768 (GRCm39) S228A probably damaging Het
Or2ak7 T C 11: 58,574,722 (GRCm39) C8R probably benign Het
Or2t29 A T 11: 58,433,782 (GRCm39) C186* probably null Het
Or2t44 T A 11: 58,677,559 (GRCm39) F166L possibly damaging Het
Or4c119 C T 2: 88,986,719 (GRCm39) E267K possibly damaging Het
Or56b1 C T 7: 104,285,291 (GRCm39) R137C probably benign Het
Pcdha8 C A 18: 37,126,285 (GRCm39) P256T possibly damaging Het
Pmm1 C T 15: 81,839,896 (GRCm39) R143H probably damaging Het
Ptprn A T 1: 75,229,018 (GRCm39) M799K probably damaging Het
Rhpn2 A T 7: 35,083,473 (GRCm39) probably benign Het
Sae1 A G 7: 16,070,668 (GRCm39) F281L probably benign Het
Slc25a23 A G 17: 57,354,309 (GRCm39) Y366H probably benign Het
Slc25a25 G T 2: 32,309,175 (GRCm39) T222K probably damaging Het
Smarca2 T A 19: 26,659,452 (GRCm39) F914Y possibly damaging Het
Spef2 C A 15: 9,653,091 (GRCm39) V897L probably benign Het
Spon2 C A 5: 33,374,054 (GRCm39) E110* probably null Het
Sstr2 A G 11: 113,515,177 (GRCm39) N32S probably benign Het
Stk4 T C 2: 163,959,985 (GRCm39) V415A probably benign Het
Tcaf1 T G 6: 42,654,372 (GRCm39) T607P probably benign Het
Ush1c C A 7: 45,850,480 (GRCm39) L766F probably damaging Het
Usp9y T C Y: 1,383,354 (GRCm39) I795V probably benign Het
Vmn1r43 G A 6: 89,846,877 (GRCm39) T203M probably damaging Het
Vmn2r53 A G 7: 12,340,231 (GRCm39) S81P probably damaging Het
Vps45 A G 3: 95,960,345 (GRCm39) probably benign Het
Wdr6 A G 9: 108,451,627 (GRCm39) V752A probably benign Het
Xkr4 G A 1: 3,286,358 (GRCm39) R611* probably null Het
Zfp236 A G 18: 82,638,469 (GRCm39) S1384P possibly damaging Het
Zfp800 A T 6: 28,243,215 (GRCm39) N583K probably benign Het
Zpld1 T C 16: 55,061,764 (GRCm39) S206G probably benign Het
Zxdc T A 6: 90,349,821 (GRCm39) S372R probably damaging Het
Other mutations in Zc3h6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01732:Zc3h6 APN 2 128,853,795 (GRCm39) missense probably damaging 1.00
IGL01880:Zc3h6 APN 2 128,859,298 (GRCm39) missense probably damaging 0.99
IGL02160:Zc3h6 APN 2 128,839,605 (GRCm39) missense probably benign 0.02
IGL02161:Zc3h6 APN 2 128,835,146 (GRCm39) missense possibly damaging 0.90
IGL02202:Zc3h6 APN 2 128,858,501 (GRCm39) missense probably damaging 1.00
IGL02547:Zc3h6 APN 2 128,857,531 (GRCm39) missense probably benign 0.00
IGL02973:Zc3h6 APN 2 128,839,715 (GRCm39) missense probably damaging 0.98
BB001:Zc3h6 UTSW 2 128,857,400 (GRCm39) missense possibly damaging 0.52
BB011:Zc3h6 UTSW 2 128,857,400 (GRCm39) missense possibly damaging 0.52
R0336:Zc3h6 UTSW 2 128,857,332 (GRCm39) missense possibly damaging 0.81
R0420:Zc3h6 UTSW 2 128,856,747 (GRCm39) missense probably benign 0.00
R0538:Zc3h6 UTSW 2 128,859,143 (GRCm39) missense possibly damaging 0.75
R0944:Zc3h6 UTSW 2 128,848,736 (GRCm39) missense probably damaging 1.00
R1151:Zc3h6 UTSW 2 128,859,056 (GRCm39) missense probably benign 0.00
R1528:Zc3h6 UTSW 2 128,858,989 (GRCm39) missense probably benign 0.01
R1698:Zc3h6 UTSW 2 128,859,278 (GRCm39) missense probably benign
R1712:Zc3h6 UTSW 2 128,858,654 (GRCm39) missense probably damaging 1.00
R1913:Zc3h6 UTSW 2 128,858,540 (GRCm39) missense probably damaging 1.00
R1926:Zc3h6 UTSW 2 128,839,715 (GRCm39) missense probably damaging 0.98
R2030:Zc3h6 UTSW 2 128,848,006 (GRCm39) missense probably damaging 1.00
R2051:Zc3h6 UTSW 2 128,857,538 (GRCm39) missense possibly damaging 0.55
R2133:Zc3h6 UTSW 2 128,809,750 (GRCm39) missense possibly damaging 0.53
R2273:Zc3h6 UTSW 2 128,856,629 (GRCm39) missense probably benign 0.01
R2328:Zc3h6 UTSW 2 128,835,122 (GRCm39) missense possibly damaging 0.85
R2862:Zc3h6 UTSW 2 128,857,380 (GRCm39) missense probably benign 0.43
R2899:Zc3h6 UTSW 2 128,844,152 (GRCm39) missense probably benign 0.00
R3711:Zc3h6 UTSW 2 128,859,251 (GRCm39) missense probably benign 0.00
R3743:Zc3h6 UTSW 2 128,839,712 (GRCm39) missense probably damaging 1.00
R3893:Zc3h6 UTSW 2 128,858,060 (GRCm39) missense probably damaging 1.00
R4748:Zc3h6 UTSW 2 128,844,160 (GRCm39) missense probably damaging 1.00
R5025:Zc3h6 UTSW 2 128,852,353 (GRCm39) missense possibly damaging 0.87
R5026:Zc3h6 UTSW 2 128,859,229 (GRCm39) missense probably benign 0.00
R5125:Zc3h6 UTSW 2 128,856,399 (GRCm39) missense possibly damaging 0.93
R5373:Zc3h6 UTSW 2 128,844,076 (GRCm39) missense possibly damaging 0.75
R5374:Zc3h6 UTSW 2 128,844,076 (GRCm39) missense possibly damaging 0.75
R5703:Zc3h6 UTSW 2 128,835,372 (GRCm39) intron probably benign
R5802:Zc3h6 UTSW 2 128,857,479 (GRCm39) missense possibly damaging 0.56
R5876:Zc3h6 UTSW 2 128,835,197 (GRCm39) missense probably benign 0.29
R5879:Zc3h6 UTSW 2 128,839,696 (GRCm39) splice site probably null
R5950:Zc3h6 UTSW 2 128,839,710 (GRCm39) nonsense probably null
R6031:Zc3h6 UTSW 2 128,809,732 (GRCm39) missense possibly damaging 0.85
R6031:Zc3h6 UTSW 2 128,809,732 (GRCm39) missense possibly damaging 0.85
R6781:Zc3h6 UTSW 2 128,857,341 (GRCm39) missense probably damaging 0.99
R7323:Zc3h6 UTSW 2 128,835,331 (GRCm39) missense unknown
R7340:Zc3h6 UTSW 2 128,835,110 (GRCm39) missense possibly damaging 0.90
R7572:Zc3h6 UTSW 2 128,859,172 (GRCm39) missense probably benign 0.02
R7576:Zc3h6 UTSW 2 128,856,473 (GRCm39) missense probably damaging 1.00
R7797:Zc3h6 UTSW 2 128,857,555 (GRCm39) critical splice donor site probably null
R7924:Zc3h6 UTSW 2 128,857,400 (GRCm39) missense possibly damaging 0.52
R8048:Zc3h6 UTSW 2 128,858,934 (GRCm39) missense probably benign 0.30
R8877:Zc3h6 UTSW 2 128,856,319 (GRCm39) nonsense probably null
R9577:Zc3h6 UTSW 2 128,858,102 (GRCm39) missense
R9687:Zc3h6 UTSW 2 128,859,281 (GRCm39) missense probably damaging 1.00
R9745:Zc3h6 UTSW 2 128,859,155 (GRCm39) missense probably benign 0.08
Z1176:Zc3h6 UTSW 2 128,858,141 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TAGGCTTCATAGACTGCCCAATAC -3'
(R):5'- AGGGACTTCCAAGTTTGCAG -3'

Sequencing Primer
(F):5'- TCTCATCAAGTGACTGCAAAGG -3'
(R):5'- ACTTCCAAGTTTGCAGTAGTGTTC -3'
Posted On 2021-11-19