Incidental Mutation 'R9076:Zc3h6'
ID 689774
Institutional Source Beutler Lab
Gene Symbol Zc3h6
Ensembl Gene ENSMUSG00000042851
Gene Name zinc finger CCCH type containing 6
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.159) question?
Stock # R9076 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 128967402-129018563 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) T to G at 129017176 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 1042 (Y1042*)
Ref Sequence ENSEMBL: ENSMUSP00000105949 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110320]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000110320
AA Change: Y1042*
SMART Domains Protein: ENSMUSP00000105949
Gene: ENSMUSG00000042851
AA Change: Y1042*

DomainStartEndE-ValueType
low complexity region 8 25 N/A INTRINSIC
coiled coil region 30 71 N/A INTRINSIC
low complexity region 74 88 N/A INTRINSIC
low complexity region 177 192 N/A INTRINSIC
ZnF_C3H1 271 296 1.72e-4 SMART
ZnF_C3H1 300 325 2.51e-6 SMART
ZnF_C3H1 326 349 5.24e0 SMART
coiled coil region 351 383 N/A INTRINSIC
low complexity region 385 400 N/A INTRINSIC
low complexity region 493 509 N/A INTRINSIC
low complexity region 698 707 N/A INTRINSIC
low complexity region 784 798 N/A INTRINSIC
low complexity region 815 829 N/A INTRINSIC
low complexity region 876 890 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 99% (67/68)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy7 G A 8: 88,327,708 G1064R probably damaging Het
Adcy9 A G 16: 4,288,823 V1046A probably damaging Het
Adgrv1 C T 13: 81,422,128 probably null Het
Apbb2 A C 5: 66,312,164 L554W probably damaging Het
Arhgef10 C T 8: 14,974,993 P722S probably damaging Het
Capns1 A C 7: 30,194,085 M1R probably null Het
Chst1 C T 2: 92,613,416 Q78* probably null Het
Clec12b A G 6: 129,379,617 S195P possibly damaging Het
Cog8 C T 8: 107,052,576 M356I probably damaging Het
Cyp4b1 T C 4: 115,625,227 N452D probably damaging Het
Defb40 A T 8: 18,974,978 Y71N probably benign Het
Dhx8 G T 11: 101,738,195 R190L Het
Disp1 G A 1: 183,087,235 T1207M possibly damaging Het
Dnah9 T A 11: 66,117,638 Y787F probably benign Het
Egflam T C 15: 7,207,674 N1010D probably damaging Het
Fam151a T A 4: 106,746,057 Y272N probably damaging Het
Fat1 T C 8: 45,039,901 Y3887H probably damaging Het
Fpr3 T A 17: 17,971,463 I332N probably benign Het
Frmd4a G T 2: 4,603,954 G878W probably damaging Het
Fv1 T C 4: 147,869,171 Y65H possibly damaging Het
Gabra6 G A 11: 42,307,462 A387V probably benign Het
Gm34653 A T 2: 34,839,197 Y336F probably damaging Het
Gna11 T C 10: 81,530,881 T332A Het
Gpr161 T A 1: 165,306,188 H6Q possibly damaging Het
Grin2b CA C 6: 135,732,511 probably null Het
Heatr3 A T 8: 88,150,199 M290L probably benign Het
Ifi47 T G 11: 49,096,015 I203R probably benign Het
Ighv5-8 TATACAT TAT 12: 113,654,963 probably benign Het
Klhl10 A G 11: 100,447,136 M234V possibly damaging Het
Klra4 A G 6: 130,062,144 I95T possibly damaging Het
Krt84 A G 15: 101,529,663 F286L probably damaging Het
Lrp2 A G 2: 69,519,916 V704A probably benign Het
Lypd6b A T 2: 49,947,522 S169C possibly damaging Het
Mapk12 T C 15: 89,140,408 E22G probably benign Het
Ncapg T C 5: 45,676,641 C340R probably benign Het
Ncor2 A G 5: 125,034,022 L394P Het
Nek1 T G 8: 61,028,734 S228A probably damaging Het
Olfr1224-ps1 C T 2: 89,156,375 E267K possibly damaging Het
Olfr314 T A 11: 58,786,733 F166L possibly damaging Het
Olfr320 T C 11: 58,683,896 C8R probably benign Het
Olfr329-ps A T 11: 58,542,956 C186* probably null Het
Olfr657 C T 7: 104,636,084 R137C probably benign Het
Pcdha8 C A 18: 36,993,232 P256T possibly damaging Het
Pmm1 C T 15: 81,955,695 R143H probably damaging Het
Ptprn A T 1: 75,252,374 M799K probably damaging Het
Rhpn2 A T 7: 35,384,048 probably benign Het
Sae1 A G 7: 16,336,743 F281L probably benign Het
Slc25a23 A G 17: 57,047,309 Y366H probably benign Het
Slc25a25 G T 2: 32,419,163 T222K probably damaging Het
Smarca2 T A 19: 26,682,052 F914Y possibly damaging Het
Spef2 C A 15: 9,653,005 V897L probably benign Het
Spon2 C A 5: 33,216,710 E110* probably null Het
Sstr2 A G 11: 113,624,351 N32S probably benign Het
Stk4 T C 2: 164,118,065 V415A probably benign Het
Tcaf1 T G 6: 42,677,438 T607P probably benign Het
Ush1c C A 7: 46,201,056 L766F probably damaging Het
Usp9y T C Y: 1,383,354 I795V probably benign Het
Vmn1r43 G A 6: 89,869,895 T203M probably damaging Het
Vmn2r53 A G 7: 12,606,304 S81P probably damaging Het
Vps45 A G 3: 96,053,033 probably benign Het
Wdr6 A G 9: 108,574,428 V752A probably benign Het
Xkr4 G A 1: 3,216,135 R611* probably null Het
Zfp236 A G 18: 82,620,344 S1384P possibly damaging Het
Zfp800 A T 6: 28,243,216 N583K probably benign Het
Zpld1 T C 16: 55,241,401 S206G probably benign Het
Zxdc T A 6: 90,372,839 S372R probably damaging Het
Other mutations in Zc3h6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01732:Zc3h6 APN 2 129011875 missense probably damaging 1.00
IGL01880:Zc3h6 APN 2 129017378 missense probably damaging 0.99
IGL02160:Zc3h6 APN 2 128997685 missense probably benign 0.02
IGL02161:Zc3h6 APN 2 128993226 missense possibly damaging 0.90
IGL02202:Zc3h6 APN 2 129016581 missense probably damaging 1.00
IGL02547:Zc3h6 APN 2 129015611 missense probably benign 0.00
IGL02973:Zc3h6 APN 2 128997795 missense probably damaging 0.98
BB001:Zc3h6 UTSW 2 129015480 missense possibly damaging 0.52
BB011:Zc3h6 UTSW 2 129015480 missense possibly damaging 0.52
R0336:Zc3h6 UTSW 2 129015412 missense possibly damaging 0.81
R0420:Zc3h6 UTSW 2 129014827 missense probably benign 0.00
R0538:Zc3h6 UTSW 2 129017223 missense possibly damaging 0.75
R0944:Zc3h6 UTSW 2 129006816 missense probably damaging 1.00
R1151:Zc3h6 UTSW 2 129017136 missense probably benign 0.00
R1528:Zc3h6 UTSW 2 129017069 missense probably benign 0.01
R1698:Zc3h6 UTSW 2 129017358 missense probably benign
R1712:Zc3h6 UTSW 2 129016734 missense probably damaging 1.00
R1913:Zc3h6 UTSW 2 129016620 missense probably damaging 1.00
R1926:Zc3h6 UTSW 2 128997795 missense probably damaging 0.98
R2030:Zc3h6 UTSW 2 129006086 missense probably damaging 1.00
R2051:Zc3h6 UTSW 2 129015618 missense possibly damaging 0.55
R2133:Zc3h6 UTSW 2 128967830 missense possibly damaging 0.53
R2273:Zc3h6 UTSW 2 129014709 missense probably benign 0.01
R2328:Zc3h6 UTSW 2 128993202 missense possibly damaging 0.85
R2862:Zc3h6 UTSW 2 129015460 missense probably benign 0.43
R2899:Zc3h6 UTSW 2 129002232 missense probably benign 0.00
R3711:Zc3h6 UTSW 2 129017331 missense probably benign 0.00
R3743:Zc3h6 UTSW 2 128997792 missense probably damaging 1.00
R3893:Zc3h6 UTSW 2 129016140 missense probably damaging 1.00
R4748:Zc3h6 UTSW 2 129002240 missense probably damaging 1.00
R5025:Zc3h6 UTSW 2 129010433 missense possibly damaging 0.87
R5026:Zc3h6 UTSW 2 129017309 missense probably benign 0.00
R5125:Zc3h6 UTSW 2 129014479 missense possibly damaging 0.93
R5373:Zc3h6 UTSW 2 129002156 missense possibly damaging 0.75
R5374:Zc3h6 UTSW 2 129002156 missense possibly damaging 0.75
R5703:Zc3h6 UTSW 2 128993452 intron probably benign
R5802:Zc3h6 UTSW 2 129015559 missense possibly damaging 0.56
R5876:Zc3h6 UTSW 2 128993277 missense probably benign 0.29
R5879:Zc3h6 UTSW 2 128997776 splice site probably null
R5950:Zc3h6 UTSW 2 128997790 nonsense probably null
R6031:Zc3h6 UTSW 2 128967812 missense possibly damaging 0.85
R6031:Zc3h6 UTSW 2 128967812 missense possibly damaging 0.85
R6781:Zc3h6 UTSW 2 129015421 missense probably damaging 0.99
R7323:Zc3h6 UTSW 2 128993411 missense unknown
R7340:Zc3h6 UTSW 2 128993190 missense possibly damaging 0.90
R7572:Zc3h6 UTSW 2 129017252 missense probably benign 0.02
R7576:Zc3h6 UTSW 2 129014553 missense probably damaging 1.00
R7797:Zc3h6 UTSW 2 129015635 critical splice donor site probably null
R7924:Zc3h6 UTSW 2 129015480 missense possibly damaging 0.52
R8048:Zc3h6 UTSW 2 129017014 missense probably benign 0.30
R8877:Zc3h6 UTSW 2 129014399 nonsense probably null
R9577:Zc3h6 UTSW 2 129016182 missense
R9687:Zc3h6 UTSW 2 129017361 missense probably damaging 1.00
R9745:Zc3h6 UTSW 2 129017235 missense probably benign 0.08
Z1176:Zc3h6 UTSW 2 129016221 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TAGGCTTCATAGACTGCCCAATAC -3'
(R):5'- AGGGACTTCCAAGTTTGCAG -3'

Sequencing Primer
(F):5'- TCTCATCAAGTGACTGCAAAGG -3'
(R):5'- ACTTCCAAGTTTGCAGTAGTGTTC -3'
Posted On 2021-11-19