Incidental Mutation 'R9076:Vmn1r43'
ID 689785
Institutional Source Beutler Lab
Gene Symbol Vmn1r43
Ensembl Gene ENSMUSG00000068231
Gene Name vomeronasal 1 receptor 43
Synonyms V1ra5
MMRRC Submission 068897-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.051) question?
Stock # R9076 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 89846443-89847511 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 89846877 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Methionine at position 203 (T203M)
Ref Sequence ENSEMBL: ENSMUSP00000086839 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089418] [ENSMUST00000226741] [ENSMUST00000226983] [ENSMUST00000227279] [ENSMUST00000228709]
AlphaFold Q8VIC9
Predicted Effect probably damaging
Transcript: ENSMUST00000089418
AA Change: T203M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000086839
Gene: ENSMUSG00000068231
AA Change: T203M

DomainStartEndE-ValueType
Pfam:V1R 54 318 2.9e-126 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000226741
AA Change: T203M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000226983
AA Change: T203M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000227279
Predicted Effect probably damaging
Transcript: ENSMUST00000228709
AA Change: T203M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.6329 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 99% (67/68)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy7 G A 8: 89,054,336 (GRCm39) G1064R probably damaging Het
Adcy9 A G 16: 4,106,687 (GRCm39) V1046A probably damaging Het
Adgrv1 C T 13: 81,570,247 (GRCm39) probably null Het
Apbb2 A C 5: 66,469,507 (GRCm39) L554W probably damaging Het
Arhgef10 C T 8: 15,024,993 (GRCm39) P722S probably damaging Het
B3galt9 A T 2: 34,729,209 (GRCm39) Y336F probably damaging Het
Capns1 A C 7: 29,893,510 (GRCm39) M1R probably null Het
Chst1 C T 2: 92,443,761 (GRCm39) Q78* probably null Het
Clec12b A G 6: 129,356,580 (GRCm39) S195P possibly damaging Het
Cog8 C T 8: 107,779,208 (GRCm39) M356I probably damaging Het
Cyp4b1 T C 4: 115,482,424 (GRCm39) N452D probably damaging Het
Defb40 A T 8: 19,024,994 (GRCm39) Y71N probably benign Het
Dhx8 G T 11: 101,629,021 (GRCm39) R190L Het
Disp1 G A 1: 182,868,799 (GRCm39) T1207M possibly damaging Het
Dnah9 T A 11: 66,008,464 (GRCm39) Y787F probably benign Het
Egflam T C 15: 7,237,155 (GRCm39) N1010D probably damaging Het
Fam151a T A 4: 106,603,254 (GRCm39) Y272N probably damaging Het
Fat1 T C 8: 45,492,938 (GRCm39) Y3887H probably damaging Het
Fpr3 T A 17: 18,191,725 (GRCm39) I332N probably benign Het
Frmd4a G T 2: 4,608,765 (GRCm39) G878W probably damaging Het
Fv1 T C 4: 147,953,628 (GRCm39) Y65H possibly damaging Het
Gabra6 G A 11: 42,198,289 (GRCm39) A387V probably benign Het
Gna11 T C 10: 81,366,715 (GRCm39) T332A Het
Gpr161 T A 1: 165,133,757 (GRCm39) H6Q possibly damaging Het
Grin2b CA C 6: 135,709,509 (GRCm39) probably null Het
Heatr3 A T 8: 88,876,827 (GRCm39) M290L probably benign Het
Ifi47 T G 11: 48,986,842 (GRCm39) I203R probably benign Het
Ighv5-8 TATACAT TAT 12: 113,618,583 (GRCm39) probably benign Het
Klhl10 A G 11: 100,337,962 (GRCm39) M234V possibly damaging Het
Klra4 A G 6: 130,039,107 (GRCm39) I95T possibly damaging Het
Krt84 A G 15: 101,438,098 (GRCm39) F286L probably damaging Het
Lrp2 A G 2: 69,350,260 (GRCm39) V704A probably benign Het
Lypd6b A T 2: 49,837,534 (GRCm39) S169C possibly damaging Het
Mapk12 T C 15: 89,024,611 (GRCm39) E22G probably benign Het
Ncapg T C 5: 45,833,983 (GRCm39) C340R probably benign Het
Ncor2 A G 5: 125,111,086 (GRCm39) L394P Het
Nek1 T G 8: 61,481,768 (GRCm39) S228A probably damaging Het
Or2ak7 T C 11: 58,574,722 (GRCm39) C8R probably benign Het
Or2t29 A T 11: 58,433,782 (GRCm39) C186* probably null Het
Or2t44 T A 11: 58,677,559 (GRCm39) F166L possibly damaging Het
Or4c119 C T 2: 88,986,719 (GRCm39) E267K possibly damaging Het
Or56b1 C T 7: 104,285,291 (GRCm39) R137C probably benign Het
Pcdha8 C A 18: 37,126,285 (GRCm39) P256T possibly damaging Het
Pmm1 C T 15: 81,839,896 (GRCm39) R143H probably damaging Het
Ptprn A T 1: 75,229,018 (GRCm39) M799K probably damaging Het
Rhpn2 A T 7: 35,083,473 (GRCm39) probably benign Het
Sae1 A G 7: 16,070,668 (GRCm39) F281L probably benign Het
Slc25a23 A G 17: 57,354,309 (GRCm39) Y366H probably benign Het
Slc25a25 G T 2: 32,309,175 (GRCm39) T222K probably damaging Het
Smarca2 T A 19: 26,659,452 (GRCm39) F914Y possibly damaging Het
Spef2 C A 15: 9,653,091 (GRCm39) V897L probably benign Het
Spon2 C A 5: 33,374,054 (GRCm39) E110* probably null Het
Sstr2 A G 11: 113,515,177 (GRCm39) N32S probably benign Het
Stk4 T C 2: 163,959,985 (GRCm39) V415A probably benign Het
Tcaf1 T G 6: 42,654,372 (GRCm39) T607P probably benign Het
Ush1c C A 7: 45,850,480 (GRCm39) L766F probably damaging Het
Usp9y T C Y: 1,383,354 (GRCm39) I795V probably benign Het
Vmn2r53 A G 7: 12,340,231 (GRCm39) S81P probably damaging Het
Vps45 A G 3: 95,960,345 (GRCm39) probably benign Het
Wdr6 A G 9: 108,451,627 (GRCm39) V752A probably benign Het
Xkr4 G A 1: 3,286,358 (GRCm39) R611* probably null Het
Zc3h6 T G 2: 128,859,096 (GRCm39) Y1042* probably null Het
Zfp236 A G 18: 82,638,469 (GRCm39) S1384P possibly damaging Het
Zfp800 A T 6: 28,243,215 (GRCm39) N583K probably benign Het
Zpld1 T C 16: 55,061,764 (GRCm39) S206G probably benign Het
Zxdc T A 6: 90,349,821 (GRCm39) S372R probably damaging Het
Other mutations in Vmn1r43
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01748:Vmn1r43 APN 6 89,847,294 (GRCm39) missense probably damaging 1.00
IGL02476:Vmn1r43 APN 6 89,847,043 (GRCm39) missense possibly damaging 0.95
IGL02958:Vmn1r43 APN 6 89,847,031 (GRCm39) missense probably benign 0.09
R0413:Vmn1r43 UTSW 6 89,846,830 (GRCm39) missense probably damaging 1.00
R1662:Vmn1r43 UTSW 6 89,846,572 (GRCm39) missense possibly damaging 0.76
R1668:Vmn1r43 UTSW 6 89,846,683 (GRCm39) missense probably benign 0.01
R4419:Vmn1r43 UTSW 6 89,846,629 (GRCm39) missense probably benign 0.01
R4719:Vmn1r43 UTSW 6 89,846,837 (GRCm39) missense probably benign 0.02
R4798:Vmn1r43 UTSW 6 89,846,892 (GRCm39) missense probably benign 0.01
R5520:Vmn1r43 UTSW 6 89,846,728 (GRCm39) missense probably damaging 0.98
R5643:Vmn1r43 UTSW 6 89,847,354 (GRCm39) missense probably damaging 1.00
R5644:Vmn1r43 UTSW 6 89,847,354 (GRCm39) missense probably damaging 1.00
R5717:Vmn1r43 UTSW 6 89,846,905 (GRCm39) missense probably damaging 1.00
R6647:Vmn1r43 UTSW 6 89,846,841 (GRCm39) missense probably damaging 1.00
R6914:Vmn1r43 UTSW 6 89,847,319 (GRCm39) missense probably benign 0.02
R6942:Vmn1r43 UTSW 6 89,847,319 (GRCm39) missense probably benign 0.02
R7092:Vmn1r43 UTSW 6 89,846,885 (GRCm39) missense probably benign 0.02
R7402:Vmn1r43 UTSW 6 89,846,803 (GRCm39) missense probably benign 0.02
R7457:Vmn1r43 UTSW 6 89,847,172 (GRCm39) missense probably damaging 0.98
R7572:Vmn1r43 UTSW 6 89,846,547 (GRCm39) missense possibly damaging 0.93
R7807:Vmn1r43 UTSW 6 89,847,219 (GRCm39) missense probably benign 0.07
R8406:Vmn1r43 UTSW 6 89,847,414 (GRCm39) missense possibly damaging 0.55
R8696:Vmn1r43 UTSW 6 89,847,321 (GRCm39) missense probably damaging 0.99
R8859:Vmn1r43 UTSW 6 89,846,937 (GRCm39) missense probably damaging 1.00
R8894:Vmn1r43 UTSW 6 89,846,746 (GRCm39) missense probably benign 0.02
R9072:Vmn1r43 UTSW 6 89,846,877 (GRCm39) missense probably damaging 1.00
R9073:Vmn1r43 UTSW 6 89,846,877 (GRCm39) missense probably damaging 1.00
R9075:Vmn1r43 UTSW 6 89,846,877 (GRCm39) missense probably damaging 1.00
R9237:Vmn1r43 UTSW 6 89,846,877 (GRCm39) missense probably damaging 1.00
R9239:Vmn1r43 UTSW 6 89,846,877 (GRCm39) missense probably damaging 1.00
R9240:Vmn1r43 UTSW 6 89,846,877 (GRCm39) missense probably damaging 1.00
R9293:Vmn1r43 UTSW 6 89,846,877 (GRCm39) missense probably damaging 1.00
R9383:Vmn1r43 UTSW 6 89,846,552 (GRCm39) missense possibly damaging 0.94
R9398:Vmn1r43 UTSW 6 89,846,877 (GRCm39) missense probably damaging 1.00
R9399:Vmn1r43 UTSW 6 89,846,877 (GRCm39) missense probably damaging 1.00
R9401:Vmn1r43 UTSW 6 89,846,877 (GRCm39) missense probably damaging 1.00
R9402:Vmn1r43 UTSW 6 89,846,877 (GRCm39) missense probably damaging 1.00
R9594:Vmn1r43 UTSW 6 89,846,877 (GRCm39) missense probably damaging 1.00
R9595:Vmn1r43 UTSW 6 89,846,877 (GRCm39) missense probably damaging 1.00
R9596:Vmn1r43 UTSW 6 89,846,877 (GRCm39) missense probably damaging 1.00
R9624:Vmn1r43 UTSW 6 89,846,877 (GRCm39) missense probably damaging 1.00
R9628:Vmn1r43 UTSW 6 89,846,877 (GRCm39) missense probably damaging 1.00
R9656:Vmn1r43 UTSW 6 89,847,440 (GRCm39) missense possibly damaging 0.47
X0020:Vmn1r43 UTSW 6 89,847,316 (GRCm39) missense probably benign 0.00
Z1177:Vmn1r43 UTSW 6 89,847,467 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGTCATGAGCATCAGGATGG -3'
(R):5'- CATTCTTAGTCCCAGAAGCTCC -3'

Sequencing Primer
(F):5'- CATCAGGATGGTCTGGGTAGCAC -3'
(R):5'- GTCCCAGAAGCTCCTGTTTATCAAAG -3'
Posted On 2021-11-19