Incidental Mutation 'R9076:Grin2b'
ID689789
Institutional Source Beutler Lab
Gene Symbol Grin2b
Ensembl Gene ENSMUSG00000030209
Gene Nameglutamate receptor, ionotropic, NMDA2B (epsilon 2)
SynonymsGluRepsilon2, NMDAR2B, GluN2B, Nmdar2b, NR2B
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R9076 (G1)
Quality Score217.468
Status Not validated
Chromosome6
Chromosomal Location135713233-136173511 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) CA to C at 135732511 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000062284 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053880] [ENSMUST00000111905]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000053880
SMART Domains Protein: ENSMUSP00000062284
Gene: ENSMUSG00000030209

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:ANF_receptor 106 306 8.6e-10 PFAM
PBPe 431 799 1.06e-67 SMART
Lig_chan-Glu_bd 440 503 1.82e-22 SMART
Pfam:NMDAR2_C 840 1482 4.8e-270 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000111905
SMART Domains Protein: ENSMUSP00000107536
Gene: ENSMUSG00000030209

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:ANF_receptor 56 307 4.2e-10 PFAM
PBPe 431 799 1.06e-67 SMART
Lig_chan-Glu_bd 440 503 1.82e-22 SMART
Pfam:NMDAR2_C 840 1482 2.1e-245 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] N-methyl-D-aspartate (NMDA) receptors are a class of ionotropic glutamate receptors. NMDA receptor channel has been shown to be involved in long-term potentiation, an activity-dependent increase in the efficiency of synaptic transmission thought to underlie certain kinds of memory and learning. NMDA receptor channels are heteromers composed of three different subunits: NR1 (GRIN1), NR2 (GRIN2A, GRIN2B, GRIN2C, or GRIN2D) and NR3 (GRIN3A or GRIN3B). The NR2 subunit acts as the agonist binding site for glutamate. This receptor is the predominant excitatory neurotransmitter receptor in the mammalian brain. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impairments in suckling, in hippocampal long term depression, and in pattern formation of trigeminal nucleus sensory afferent terminals. Mutants die shortly after birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik CGAATCTGCACACTGAGGACTTGGCCCTGGGATGCATGCAGGAGAATCTGCACACTGAGGACTTGGCCCTGGGATGCATGCAGGAGAATCTGCACACTGAGGACTTGGCCCTGGGATGCATGCAGGAGAATCTGCACACTGAGGACTTGGCCCTGGGATGTATGCAGGAGAATCTGCACACTGAGGACTTGGCCCTGGG CGAATCTGCACACTGAGGACTTGGCCCTGGGATGCATGCAGGAGAATCTGCACACTGAGGACTTGGCCCTGGGATGCATGCAGGAGAATCTGCACACTGAGGACTTGGCCCTGGGATGTATGCAGGAGAATCTGCACACTGAGGACTTGGCCCTGGG 10: 82,288,556 probably benign Het
Adcy7 G A 8: 88,327,708 G1064R probably damaging Het
Adcy9 A G 16: 4,288,823 V1046A probably damaging Het
Adgrv1 C T 13: 81,422,128 probably null Het
Apbb2 A C 5: 66,312,164 L554W probably damaging Het
Arhgef10 C T 8: 14,974,993 P722S probably damaging Het
Capns1 A C 7: 30,194,085 M1R probably null Het
Chst1 C T 2: 92,613,416 Q78* probably null Het
Clec12b A G 6: 129,379,617 S195P possibly damaging Het
Cog8 C T 8: 107,052,576 M356I probably damaging Het
Cyp4b1 T C 4: 115,625,227 N452D probably damaging Het
Defb40 A T 8: 18,974,978 Y71N probably benign Het
Dhx8 G T 11: 101,738,195 R190L Het
Disp1 G A 1: 183,087,235 T1207M possibly damaging Het
Dnah9 T A 11: 66,117,638 Y787F probably benign Het
Egflam T C 15: 7,207,674 N1010D probably damaging Het
Fam151a T A 4: 106,746,057 Y272N probably damaging Het
Fat1 T C 8: 45,039,901 Y3887H probably damaging Het
Fpr3 T A 17: 17,971,463 I332N probably benign Het
Frmd4a G T 2: 4,603,954 G878W probably damaging Het
Fv1 T C 4: 147,869,171 Y65H possibly damaging Het
Gabra6 G A 11: 42,307,462 A387V probably benign Het
Gm34653 A T 2: 34,839,197 Y336F probably damaging Het
Gna11 T C 10: 81,530,881 T332A Het
Gpr161 T A 1: 165,306,188 H6Q possibly damaging Het
Heatr3 A T 8: 88,150,199 M290L probably benign Het
Ifi47 T G 11: 49,096,015 I203R probably benign Het
Ighv5-8 TATACAT TAT 12: 113,654,963 probably benign Het
Klhl10 A G 11: 100,447,136 M234V possibly damaging Het
Klra4 A G 6: 130,062,144 I95T possibly damaging Het
Krt84 A G 15: 101,529,663 F286L probably damaging Het
Lrp2 A G 2: 69,519,916 V704A probably benign Het
Lypd6b A T 2: 49,947,522 S169C possibly damaging Het
Mapk12 T C 15: 89,140,408 E22G probably benign Het
Ncapg T C 5: 45,676,641 C340R probably benign Het
Ncor2 A G 5: 125,034,022 L394P Het
Nek1 T G 8: 61,028,734 S228A probably damaging Het
Olfr1224-ps1 C T 2: 89,156,375 E267K possibly damaging Het
Olfr314 T A 11: 58,786,733 F166L possibly damaging Het
Olfr320 T C 11: 58,683,896 C8R probably benign Het
Olfr329-ps A T 11: 58,542,956 C186* probably null Het
Olfr657 C T 7: 104,636,084 R137C probably benign Het
Pcdha8 C A 18: 36,993,232 P256T possibly damaging Het
Pmm1 C T 15: 81,955,695 R143H probably damaging Het
Ptprn A T 1: 75,252,374 M799K probably damaging Het
Sae1 A G 7: 16,336,743 F281L probably benign Het
Slc25a23 A G 17: 57,047,309 Y366H probably benign Het
Slc25a25 G T 2: 32,419,163 T222K probably damaging Het
Smarca2 T A 19: 26,682,052 F914Y possibly damaging Het
Spef2 C A 15: 9,653,005 V897L probably benign Het
Spon2 C A 5: 33,216,710 E110* probably null Het
Sstr2 A G 11: 113,624,351 N32S probably benign Het
Stk4 T C 2: 164,118,065 V415A probably benign Het
Tcaf1 T G 6: 42,677,438 T607P probably benign Het
Ush1c C A 7: 46,201,056 L766F probably damaging Het
Usp9y T C Y: 1,383,354 I795V probably benign Het
Vmn1r43 G A 6: 89,869,895 T203M probably damaging Het
Vmn2r53 A G 7: 12,606,304 S81P probably damaging Het
Wdr6 A G 9: 108,574,428 V752A probably benign Het
Xkr4 G A 1: 3,216,135 R611* probably null Het
Zc3h6 T G 2: 129,017,176 Y1042* probably null Het
Zfp236 A G 18: 82,620,344 S1384P possibly damaging Het
Zfp800 A T 6: 28,243,216 N583K probably benign Het
Zpld1 T C 16: 55,241,401 S206G probably benign Het
Zxdc T A 6: 90,372,839 S372R probably damaging Het
Other mutations in Grin2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:Grin2b APN 6 135736331 missense possibly damaging 0.55
IGL00835:Grin2b APN 6 135733570 missense probably damaging 1.00
IGL01401:Grin2b APN 6 135736363 missense probably damaging 1.00
IGL01523:Grin2b APN 6 136044265 missense probably null 0.99
IGL01719:Grin2b APN 6 135733381 missense probably damaging 0.97
IGL01907:Grin2b APN 6 135733740 missense probably damaging 1.00
IGL01996:Grin2b APN 6 135732586 missense probably damaging 1.00
IGL02309:Grin2b APN 6 135736472 missense probably damaging 1.00
IGL02312:Grin2b APN 6 135739090 missense probably damaging 1.00
IGL02409:Grin2b APN 6 136043908 missense possibly damaging 0.89
IGL02527:Grin2b APN 6 135923391 missense probably damaging 1.00
IGL02535:Grin2b APN 6 135779369 missense possibly damaging 0.70
IGL02570:Grin2b APN 6 135922998 missense probably damaging 1.00
IGL02702:Grin2b APN 6 135739132 missense probably damaging 0.99
IGL03001:Grin2b APN 6 135739115 missense probably damaging 1.00
IGL03274:Grin2b APN 6 135780255 missense possibly damaging 0.90
R0055:Grin2b UTSW 6 135923203 missense probably benign
R0055:Grin2b UTSW 6 135923203 missense probably benign
R0164:Grin2b UTSW 6 135778648 splice site probably benign
R0194:Grin2b UTSW 6 135779305 missense probably damaging 1.00
R0594:Grin2b UTSW 6 135733929 missense probably damaging 1.00
R1434:Grin2b UTSW 6 135843195 missense probably benign 0.04
R1928:Grin2b UTSW 6 136044046 missense probably damaging 1.00
R1942:Grin2b UTSW 6 135732732 missense possibly damaging 0.93
R1996:Grin2b UTSW 6 136044211 missense possibly damaging 0.52
R2002:Grin2b UTSW 6 135733245 missense probably damaging 1.00
R2020:Grin2b UTSW 6 135733896 missense probably benign 0.12
R2103:Grin2b UTSW 6 135780140 missense probably benign 0.02
R2127:Grin2b UTSW 6 135778700 missense probably benign 0.03
R2495:Grin2b UTSW 6 135733182 missense probably damaging 1.00
R2656:Grin2b UTSW 6 135733429 missense probably damaging 1.00
R2847:Grin2b UTSW 6 135740953 missense probably damaging 1.00
R2866:Grin2b UTSW 6 135733639 missense probably damaging 1.00
R2867:Grin2b UTSW 6 135733639 missense probably damaging 1.00
R2867:Grin2b UTSW 6 135733639 missense probably damaging 1.00
R3196:Grin2b UTSW 6 135732455 small deletion probably benign
R3418:Grin2b UTSW 6 135843110 missense probably benign 0.02
R3808:Grin2b UTSW 6 135923271 missense probably damaging 0.99
R4028:Grin2b UTSW 6 135736435 missense probably damaging 1.00
R4602:Grin2b UTSW 6 135778741 missense probably damaging 1.00
R4624:Grin2b UTSW 6 135733825 missense probably damaging 0.99
R4677:Grin2b UTSW 6 135774872 missense probably benign 0.13
R4744:Grin2b UTSW 6 135778699 missense probably damaging 1.00
R5020:Grin2b UTSW 6 135733407 missense probably benign 0.01
R5051:Grin2b UTSW 6 135779395 missense possibly damaging 0.84
R5105:Grin2b UTSW 6 135732441 missense probably benign 0.03
R5125:Grin2b UTSW 6 135923299 missense possibly damaging 0.89
R5146:Grin2b UTSW 6 135779342 missense probably damaging 1.00
R5318:Grin2b UTSW 6 135733918 missense probably damaging 0.99
R5349:Grin2b UTSW 6 136044283 missense possibly damaging 0.93
R5426:Grin2b UTSW 6 135732368 missense probably damaging 1.00
R5438:Grin2b UTSW 6 135736306 missense probably damaging 1.00
R5439:Grin2b UTSW 6 135736306 missense probably damaging 1.00
R5440:Grin2b UTSW 6 135736306 missense probably damaging 1.00
R5530:Grin2b UTSW 6 135733723 missense probably benign 0.00
R5603:Grin2b UTSW 6 135923397 missense probably damaging 1.00
R5657:Grin2b UTSW 6 135733087 missense possibly damaging 0.48
R5788:Grin2b UTSW 6 135740964 missense probably benign 0.24
R5941:Grin2b UTSW 6 135736373 missense probably damaging 0.99
R6057:Grin2b UTSW 6 135733944 missense possibly damaging 0.84
R6137:Grin2b UTSW 6 135923458 missense possibly damaging 0.89
R6216:Grin2b UTSW 6 135772399 missense probably damaging 1.00
R6309:Grin2b UTSW 6 135733027 missense probably benign 0.00
R6316:Grin2b UTSW 6 135780279 missense probably benign 0.00
R6419:Grin2b UTSW 6 135740967 missense probably damaging 1.00
R6551:Grin2b UTSW 6 135733344 missense probably damaging 1.00
R6612:Grin2b UTSW 6 135740998 missense probably damaging 1.00
R6616:Grin2b UTSW 6 135732551 missense probably benign
R6647:Grin2b UTSW 6 135733110 missense probably damaging 1.00
R6806:Grin2b UTSW 6 135774828 missense possibly damaging 0.84
R6976:Grin2b UTSW 6 135780200 missense probably benign
R7033:Grin2b UTSW 6 135923038 missense probably damaging 1.00
R7058:Grin2b UTSW 6 135780306 missense probably damaging 0.97
R7144:Grin2b UTSW 6 135733476 missense possibly damaging 0.50
R7190:Grin2b UTSW 6 135732948 missense possibly damaging 0.46
R7238:Grin2b UTSW 6 135780251 missense probably damaging 0.97
R7453:Grin2b UTSW 6 135740949 missense possibly damaging 0.56
R7553:Grin2b UTSW 6 135772396 missense possibly damaging 0.88
R7585:Grin2b UTSW 6 135779303 missense probably damaging 0.99
R7615:Grin2b UTSW 6 135923364 missense probably damaging 1.00
R7632:Grin2b UTSW 6 135732555 missense probably benign 0.02
R7779:Grin2b UTSW 6 135778794 nonsense probably null
R8058:Grin2b UTSW 6 135733227 missense probably damaging 1.00
R8084:Grin2b UTSW 6 135733488 missense probably benign 0.03
R8145:Grin2b UTSW 6 135732499 missense probably benign 0.01
R8308:Grin2b UTSW 6 135923076 missense probably damaging 0.99
R8357:Grin2b UTSW 6 135732199 missense probably benign 0.00
R8379:Grin2b UTSW 6 135922969 missense probably damaging 1.00
R8429:Grin2b UTSW 6 135733916 missense probably damaging 1.00
R8457:Grin2b UTSW 6 135732199 missense probably benign 0.00
R8746:Grin2b UTSW 6 135922987 missense probably benign 0.02
R8925:Grin2b UTSW 6 135772341 missense probably damaging 0.97
R8927:Grin2b UTSW 6 135772341 missense probably damaging 0.97
R8963:Grin2b UTSW 6 136044009 missense probably damaging 1.00
R9075:Grin2b UTSW 6 135732511 frame shift probably null
RF001:Grin2b UTSW 6 136044240 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAGTCCGGCCTTGTTTTCGAC -3'
(R):5'- GACTAATTCCAAGGCCCAGAAG -3'

Sequencing Primer
(F):5'- CTGCCTGAAGAAGTAGGATTTGC -3'
(R):5'- TTCCAAGGCCCAGAAGAAGAATCG -3'
Posted On2021-11-19