Incidental Mutation 'R9076:Grin2b'
ID 689789
Institutional Source Beutler Lab
Gene Symbol Grin2b
Ensembl Gene ENSMUSG00000030209
Gene Name glutamate receptor, ionotropic, NMDA2B (epsilon 2)
Synonyms GluRepsilon2, GluN2B, NR2B, NMDAR2B, Nmdar2b
MMRRC Submission 068897-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9076 (G1)
Quality Score 217.468
Status Validated
Chromosome 6
Chromosomal Location 135690231-136150509 bp(-) (GRCm39)
Type of Mutation frame shift
DNA Base Change (assembly) CA to C at 135709509 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000062284 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053880] [ENSMUST00000111905]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000053880
SMART Domains Protein: ENSMUSP00000062284
Gene: ENSMUSG00000030209

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:ANF_receptor 106 306 8.6e-10 PFAM
PBPe 431 799 1.06e-67 SMART
Lig_chan-Glu_bd 440 503 1.82e-22 SMART
Pfam:NMDAR2_C 840 1482 4.8e-270 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000111905
SMART Domains Protein: ENSMUSP00000107536
Gene: ENSMUSG00000030209

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:ANF_receptor 56 307 4.2e-10 PFAM
PBPe 431 799 1.06e-67 SMART
Lig_chan-Glu_bd 440 503 1.82e-22 SMART
Pfam:NMDAR2_C 840 1482 2.1e-245 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] N-methyl-D-aspartate (NMDA) receptors are a class of ionotropic glutamate receptors. NMDA receptor channel has been shown to be involved in long-term potentiation, an activity-dependent increase in the efficiency of synaptic transmission thought to underlie certain kinds of memory and learning. NMDA receptor channels are heteromers composed of three different subunits: NR1 (GRIN1), NR2 (GRIN2A, GRIN2B, GRIN2C, or GRIN2D) and NR3 (GRIN3A or GRIN3B). The NR2 subunit acts as the agonist binding site for glutamate. This receptor is the predominant excitatory neurotransmitter receptor in the mammalian brain. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impairments in suckling, in hippocampal long term depression, and in pattern formation of trigeminal nucleus sensory afferent terminals. Mutants die shortly after birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy7 G A 8: 89,054,336 (GRCm39) G1064R probably damaging Het
Adcy9 A G 16: 4,106,687 (GRCm39) V1046A probably damaging Het
Adgrv1 C T 13: 81,570,247 (GRCm39) probably null Het
Apbb2 A C 5: 66,469,507 (GRCm39) L554W probably damaging Het
Arhgef10 C T 8: 15,024,993 (GRCm39) P722S probably damaging Het
B3galt9 A T 2: 34,729,209 (GRCm39) Y336F probably damaging Het
Capns1 A C 7: 29,893,510 (GRCm39) M1R probably null Het
Chst1 C T 2: 92,443,761 (GRCm39) Q78* probably null Het
Clec12b A G 6: 129,356,580 (GRCm39) S195P possibly damaging Het
Cog8 C T 8: 107,779,208 (GRCm39) M356I probably damaging Het
Cyp4b1 T C 4: 115,482,424 (GRCm39) N452D probably damaging Het
Defb40 A T 8: 19,024,994 (GRCm39) Y71N probably benign Het
Dhx8 G T 11: 101,629,021 (GRCm39) R190L Het
Disp1 G A 1: 182,868,799 (GRCm39) T1207M possibly damaging Het
Dnah9 T A 11: 66,008,464 (GRCm39) Y787F probably benign Het
Egflam T C 15: 7,237,155 (GRCm39) N1010D probably damaging Het
Fam151a T A 4: 106,603,254 (GRCm39) Y272N probably damaging Het
Fat1 T C 8: 45,492,938 (GRCm39) Y3887H probably damaging Het
Fpr3 T A 17: 18,191,725 (GRCm39) I332N probably benign Het
Frmd4a G T 2: 4,608,765 (GRCm39) G878W probably damaging Het
Fv1 T C 4: 147,953,628 (GRCm39) Y65H possibly damaging Het
Gabra6 G A 11: 42,198,289 (GRCm39) A387V probably benign Het
Gna11 T C 10: 81,366,715 (GRCm39) T332A Het
Gpr161 T A 1: 165,133,757 (GRCm39) H6Q possibly damaging Het
Heatr3 A T 8: 88,876,827 (GRCm39) M290L probably benign Het
Ifi47 T G 11: 48,986,842 (GRCm39) I203R probably benign Het
Ighv5-8 TATACAT TAT 12: 113,618,583 (GRCm39) probably benign Het
Klhl10 A G 11: 100,337,962 (GRCm39) M234V possibly damaging Het
Klra4 A G 6: 130,039,107 (GRCm39) I95T possibly damaging Het
Krt84 A G 15: 101,438,098 (GRCm39) F286L probably damaging Het
Lrp2 A G 2: 69,350,260 (GRCm39) V704A probably benign Het
Lypd6b A T 2: 49,837,534 (GRCm39) S169C possibly damaging Het
Mapk12 T C 15: 89,024,611 (GRCm39) E22G probably benign Het
Ncapg T C 5: 45,833,983 (GRCm39) C340R probably benign Het
Ncor2 A G 5: 125,111,086 (GRCm39) L394P Het
Nek1 T G 8: 61,481,768 (GRCm39) S228A probably damaging Het
Or2ak7 T C 11: 58,574,722 (GRCm39) C8R probably benign Het
Or2t29 A T 11: 58,433,782 (GRCm39) C186* probably null Het
Or2t44 T A 11: 58,677,559 (GRCm39) F166L possibly damaging Het
Or4c119 C T 2: 88,986,719 (GRCm39) E267K possibly damaging Het
Or56b1 C T 7: 104,285,291 (GRCm39) R137C probably benign Het
Pcdha8 C A 18: 37,126,285 (GRCm39) P256T possibly damaging Het
Pmm1 C T 15: 81,839,896 (GRCm39) R143H probably damaging Het
Ptprn A T 1: 75,229,018 (GRCm39) M799K probably damaging Het
Rhpn2 A T 7: 35,083,473 (GRCm39) probably benign Het
Sae1 A G 7: 16,070,668 (GRCm39) F281L probably benign Het
Slc25a23 A G 17: 57,354,309 (GRCm39) Y366H probably benign Het
Slc25a25 G T 2: 32,309,175 (GRCm39) T222K probably damaging Het
Smarca2 T A 19: 26,659,452 (GRCm39) F914Y possibly damaging Het
Spef2 C A 15: 9,653,091 (GRCm39) V897L probably benign Het
Spon2 C A 5: 33,374,054 (GRCm39) E110* probably null Het
Sstr2 A G 11: 113,515,177 (GRCm39) N32S probably benign Het
Stk4 T C 2: 163,959,985 (GRCm39) V415A probably benign Het
Tcaf1 T G 6: 42,654,372 (GRCm39) T607P probably benign Het
Ush1c C A 7: 45,850,480 (GRCm39) L766F probably damaging Het
Usp9y T C Y: 1,383,354 (GRCm39) I795V probably benign Het
Vmn1r43 G A 6: 89,846,877 (GRCm39) T203M probably damaging Het
Vmn2r53 A G 7: 12,340,231 (GRCm39) S81P probably damaging Het
Vps45 A G 3: 95,960,345 (GRCm39) probably benign Het
Wdr6 A G 9: 108,451,627 (GRCm39) V752A probably benign Het
Xkr4 G A 1: 3,286,358 (GRCm39) R611* probably null Het
Zc3h6 T G 2: 128,859,096 (GRCm39) Y1042* probably null Het
Zfp236 A G 18: 82,638,469 (GRCm39) S1384P possibly damaging Het
Zfp800 A T 6: 28,243,215 (GRCm39) N583K probably benign Het
Zpld1 T C 16: 55,061,764 (GRCm39) S206G probably benign Het
Zxdc T A 6: 90,349,821 (GRCm39) S372R probably damaging Het
Other mutations in Grin2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:Grin2b APN 6 135,713,329 (GRCm39) missense possibly damaging 0.55
IGL00835:Grin2b APN 6 135,710,568 (GRCm39) missense probably damaging 1.00
IGL01401:Grin2b APN 6 135,713,361 (GRCm39) missense probably damaging 1.00
IGL01523:Grin2b APN 6 136,021,263 (GRCm39) missense probably null 0.99
IGL01719:Grin2b APN 6 135,710,379 (GRCm39) missense probably damaging 0.97
IGL01907:Grin2b APN 6 135,710,738 (GRCm39) missense probably damaging 1.00
IGL01996:Grin2b APN 6 135,709,584 (GRCm39) missense probably damaging 1.00
IGL02309:Grin2b APN 6 135,713,470 (GRCm39) missense probably damaging 1.00
IGL02312:Grin2b APN 6 135,716,088 (GRCm39) missense probably damaging 1.00
IGL02409:Grin2b APN 6 136,020,906 (GRCm39) missense possibly damaging 0.89
IGL02527:Grin2b APN 6 135,900,389 (GRCm39) missense probably damaging 1.00
IGL02535:Grin2b APN 6 135,756,367 (GRCm39) missense possibly damaging 0.70
IGL02570:Grin2b APN 6 135,899,996 (GRCm39) missense probably damaging 1.00
IGL02702:Grin2b APN 6 135,716,130 (GRCm39) missense probably damaging 0.99
IGL03001:Grin2b APN 6 135,716,113 (GRCm39) missense probably damaging 1.00
IGL03274:Grin2b APN 6 135,757,253 (GRCm39) missense possibly damaging 0.90
R0055:Grin2b UTSW 6 135,900,201 (GRCm39) missense probably benign
R0055:Grin2b UTSW 6 135,900,201 (GRCm39) missense probably benign
R0164:Grin2b UTSW 6 135,755,646 (GRCm39) splice site probably benign
R0194:Grin2b UTSW 6 135,756,303 (GRCm39) missense probably damaging 1.00
R0594:Grin2b UTSW 6 135,710,927 (GRCm39) missense probably damaging 1.00
R1434:Grin2b UTSW 6 135,820,193 (GRCm39) missense probably benign 0.04
R1928:Grin2b UTSW 6 136,021,044 (GRCm39) missense probably damaging 1.00
R1942:Grin2b UTSW 6 135,709,730 (GRCm39) missense possibly damaging 0.93
R1996:Grin2b UTSW 6 136,021,209 (GRCm39) missense possibly damaging 0.52
R2002:Grin2b UTSW 6 135,710,243 (GRCm39) missense probably damaging 1.00
R2020:Grin2b UTSW 6 135,710,894 (GRCm39) missense probably benign 0.12
R2103:Grin2b UTSW 6 135,757,138 (GRCm39) missense probably benign 0.02
R2127:Grin2b UTSW 6 135,755,698 (GRCm39) missense probably benign 0.03
R2495:Grin2b UTSW 6 135,710,180 (GRCm39) missense probably damaging 1.00
R2656:Grin2b UTSW 6 135,710,427 (GRCm39) missense probably damaging 1.00
R2847:Grin2b UTSW 6 135,717,951 (GRCm39) missense probably damaging 1.00
R2866:Grin2b UTSW 6 135,710,637 (GRCm39) missense probably damaging 1.00
R2867:Grin2b UTSW 6 135,710,637 (GRCm39) missense probably damaging 1.00
R2867:Grin2b UTSW 6 135,710,637 (GRCm39) missense probably damaging 1.00
R3196:Grin2b UTSW 6 135,709,453 (GRCm39) small deletion probably benign
R3418:Grin2b UTSW 6 135,820,108 (GRCm39) missense probably benign 0.02
R3808:Grin2b UTSW 6 135,900,269 (GRCm39) missense probably damaging 0.99
R4028:Grin2b UTSW 6 135,713,433 (GRCm39) missense probably damaging 1.00
R4602:Grin2b UTSW 6 135,755,739 (GRCm39) missense probably damaging 1.00
R4624:Grin2b UTSW 6 135,710,823 (GRCm39) missense probably damaging 0.99
R4677:Grin2b UTSW 6 135,751,870 (GRCm39) missense probably benign 0.13
R4744:Grin2b UTSW 6 135,755,697 (GRCm39) missense probably damaging 1.00
R5020:Grin2b UTSW 6 135,710,405 (GRCm39) missense probably benign 0.01
R5051:Grin2b UTSW 6 135,756,393 (GRCm39) missense possibly damaging 0.84
R5105:Grin2b UTSW 6 135,709,439 (GRCm39) missense probably benign 0.03
R5125:Grin2b UTSW 6 135,900,297 (GRCm39) missense possibly damaging 0.89
R5146:Grin2b UTSW 6 135,756,340 (GRCm39) missense probably damaging 1.00
R5318:Grin2b UTSW 6 135,710,916 (GRCm39) missense probably damaging 0.99
R5349:Grin2b UTSW 6 136,021,281 (GRCm39) missense possibly damaging 0.93
R5426:Grin2b UTSW 6 135,709,366 (GRCm39) missense probably damaging 1.00
R5438:Grin2b UTSW 6 135,713,304 (GRCm39) missense probably damaging 1.00
R5439:Grin2b UTSW 6 135,713,304 (GRCm39) missense probably damaging 1.00
R5440:Grin2b UTSW 6 135,713,304 (GRCm39) missense probably damaging 1.00
R5530:Grin2b UTSW 6 135,710,721 (GRCm39) missense probably benign 0.00
R5603:Grin2b UTSW 6 135,900,395 (GRCm39) missense probably damaging 1.00
R5657:Grin2b UTSW 6 135,710,085 (GRCm39) missense possibly damaging 0.48
R5788:Grin2b UTSW 6 135,717,962 (GRCm39) missense probably benign 0.24
R5941:Grin2b UTSW 6 135,713,371 (GRCm39) missense probably damaging 0.99
R6057:Grin2b UTSW 6 135,710,942 (GRCm39) missense possibly damaging 0.84
R6137:Grin2b UTSW 6 135,900,456 (GRCm39) missense possibly damaging 0.89
R6216:Grin2b UTSW 6 135,749,397 (GRCm39) missense probably damaging 1.00
R6309:Grin2b UTSW 6 135,710,025 (GRCm39) missense probably benign 0.00
R6316:Grin2b UTSW 6 135,757,277 (GRCm39) missense probably benign 0.00
R6419:Grin2b UTSW 6 135,717,965 (GRCm39) missense probably damaging 1.00
R6551:Grin2b UTSW 6 135,710,342 (GRCm39) missense probably damaging 1.00
R6612:Grin2b UTSW 6 135,717,996 (GRCm39) missense probably damaging 1.00
R6616:Grin2b UTSW 6 135,709,549 (GRCm39) missense probably benign
R6647:Grin2b UTSW 6 135,710,108 (GRCm39) missense probably damaging 1.00
R6806:Grin2b UTSW 6 135,751,826 (GRCm39) missense possibly damaging 0.84
R6976:Grin2b UTSW 6 135,757,198 (GRCm39) missense probably benign
R7033:Grin2b UTSW 6 135,900,036 (GRCm39) missense probably damaging 1.00
R7058:Grin2b UTSW 6 135,757,304 (GRCm39) missense probably damaging 0.97
R7144:Grin2b UTSW 6 135,710,474 (GRCm39) missense possibly damaging 0.50
R7190:Grin2b UTSW 6 135,709,946 (GRCm39) missense possibly damaging 0.46
R7238:Grin2b UTSW 6 135,757,249 (GRCm39) missense probably damaging 0.97
R7453:Grin2b UTSW 6 135,717,947 (GRCm39) missense possibly damaging 0.56
R7553:Grin2b UTSW 6 135,749,394 (GRCm39) missense possibly damaging 0.88
R7585:Grin2b UTSW 6 135,756,301 (GRCm39) missense probably damaging 0.99
R7615:Grin2b UTSW 6 135,900,362 (GRCm39) missense probably damaging 1.00
R7632:Grin2b UTSW 6 135,709,553 (GRCm39) missense probably benign 0.02
R7779:Grin2b UTSW 6 135,755,792 (GRCm39) nonsense probably null
R8058:Grin2b UTSW 6 135,710,225 (GRCm39) missense probably damaging 1.00
R8084:Grin2b UTSW 6 135,710,486 (GRCm39) missense probably benign 0.03
R8145:Grin2b UTSW 6 135,709,497 (GRCm39) missense probably benign 0.01
R8308:Grin2b UTSW 6 135,900,074 (GRCm39) missense probably damaging 0.99
R8357:Grin2b UTSW 6 135,709,197 (GRCm39) missense probably benign 0.00
R8379:Grin2b UTSW 6 135,899,967 (GRCm39) missense probably damaging 1.00
R8429:Grin2b UTSW 6 135,710,914 (GRCm39) missense probably damaging 1.00
R8457:Grin2b UTSW 6 135,709,197 (GRCm39) missense probably benign 0.00
R8746:Grin2b UTSW 6 135,899,985 (GRCm39) missense probably benign 0.02
R8925:Grin2b UTSW 6 135,749,339 (GRCm39) missense probably damaging 0.97
R8927:Grin2b UTSW 6 135,749,339 (GRCm39) missense probably damaging 0.97
R8963:Grin2b UTSW 6 136,021,007 (GRCm39) missense probably damaging 1.00
R9075:Grin2b UTSW 6 135,709,509 (GRCm39) frame shift probably null
R9172:Grin2b UTSW 6 135,756,255 (GRCm39) missense possibly damaging 0.84
R9520:Grin2b UTSW 6 135,710,399 (GRCm39) missense probably damaging 1.00
R9740:Grin2b UTSW 6 135,899,868 (GRCm39) critical splice donor site probably null
RF001:Grin2b UTSW 6 136,021,238 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- AAGTCCGGCCTTGTTTTCGAC -3'
(R):5'- GACTAATTCCAAGGCCCAGAAG -3'

Sequencing Primer
(F):5'- CTGCCTGAAGAAGTAGGATTTGC -3'
(R):5'- TTCCAAGGCCCAGAAGAAGAATCG -3'
Posted On 2021-11-19