Incidental Mutation 'R9076:Sae1'
ID 689791
Institutional Source Beutler Lab
Gene Symbol Sae1
Ensembl Gene ENSMUSG00000052833
Gene Name SUMO1 activating enzyme subunit 1
Synonyms HSPC140, D7Ertd177e, Uble1a, 2610044L12Rik, AOS1, 2400010M20Rik, SUMO-1 activating enzyme subunit 1
MMRRC Submission
Accession Numbers
Essential gene? Probably essential (E-score: 0.967) question?
Stock # R9076 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 16320234-16387806 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 16336743 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 281 (F281L)
Ref Sequence ENSEMBL: ENSMUSP00000092409 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094815] [ENSMUST00000210999] [ENSMUST00000211741]
AlphaFold Q9R1T2
Predicted Effect probably benign
Transcript: ENSMUST00000094815
AA Change: F281L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000092409
Gene: ENSMUSG00000052833
AA Change: F281L

DomainStartEndE-ValueType
low complexity region 3 21 N/A INTRINSIC
Pfam:ThiF 23 344 4.3e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000210999
AA Change: F281L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000211741
AA Change: F281L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Posttranslational modification of proteins by the addition of the small protein SUMO (see SUMO1; MIM 601912), or sumoylation, regulates protein structure and intracellular localization. SAE1 and UBA2 (MIM 613295) form a heterodimer that functions as a SUMO-activating enzyme for the sumoylation of proteins (Okuma et al., 1999 [PubMed 9920803]).[supplied by OMIM, Mar 2010]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy7 G A 8: 88,327,708 G1064R probably damaging Het
Adcy9 A G 16: 4,288,823 V1046A probably damaging Het
Adgrv1 C T 13: 81,422,128 probably null Het
Apbb2 A C 5: 66,312,164 L554W probably damaging Het
Arhgef10 C T 8: 14,974,993 P722S probably damaging Het
Capns1 A C 7: 30,194,085 M1R probably null Het
Chst1 C T 2: 92,613,416 Q78* probably null Het
Clec12b A G 6: 129,379,617 S195P possibly damaging Het
Cog8 C T 8: 107,052,576 M356I probably damaging Het
Cyp4b1 T C 4: 115,625,227 N452D probably damaging Het
Defb40 A T 8: 18,974,978 Y71N probably benign Het
Dhx8 G T 11: 101,738,195 R190L Het
Disp1 G A 1: 183,087,235 T1207M possibly damaging Het
Dnah9 T A 11: 66,117,638 Y787F probably benign Het
Egflam T C 15: 7,207,674 N1010D probably damaging Het
Fam151a T A 4: 106,746,057 Y272N probably damaging Het
Fat1 T C 8: 45,039,901 Y3887H probably damaging Het
Fpr3 T A 17: 17,971,463 I332N probably benign Het
Frmd4a G T 2: 4,603,954 G878W probably damaging Het
Fv1 T C 4: 147,869,171 Y65H possibly damaging Het
Gabra6 G A 11: 42,307,462 A387V probably benign Het
Gm34653 A T 2: 34,839,197 Y336F probably damaging Het
Gna11 T C 10: 81,530,881 T332A Het
Gpr161 T A 1: 165,306,188 H6Q possibly damaging Het
Grin2b CA C 6: 135,732,511 probably null Het
Heatr3 A T 8: 88,150,199 M290L probably benign Het
Ifi47 T G 11: 49,096,015 I203R probably benign Het
Ighv5-8 TATACAT TAT 12: 113,654,963 probably benign Het
Klhl10 A G 11: 100,447,136 M234V possibly damaging Het
Klra4 A G 6: 130,062,144 I95T possibly damaging Het
Krt84 A G 15: 101,529,663 F286L probably damaging Het
Lrp2 A G 2: 69,519,916 V704A probably benign Het
Lypd6b A T 2: 49,947,522 S169C possibly damaging Het
Mapk12 T C 15: 89,140,408 E22G probably benign Het
Ncapg T C 5: 45,676,641 C340R probably benign Het
Ncor2 A G 5: 125,034,022 L394P Het
Nek1 T G 8: 61,028,734 S228A probably damaging Het
Olfr1224-ps1 C T 2: 89,156,375 E267K possibly damaging Het
Olfr314 T A 11: 58,786,733 F166L possibly damaging Het
Olfr320 T C 11: 58,683,896 C8R probably benign Het
Olfr329-ps A T 11: 58,542,956 C186* probably null Het
Olfr657 C T 7: 104,636,084 R137C probably benign Het
Pcdha8 C A 18: 36,993,232 P256T possibly damaging Het
Pmm1 C T 15: 81,955,695 R143H probably damaging Het
Ptprn A T 1: 75,252,374 M799K probably damaging Het
Rhpn2 A T 7: 35,384,048 probably benign Het
Slc25a23 A G 17: 57,047,309 Y366H probably benign Het
Slc25a25 G T 2: 32,419,163 T222K probably damaging Het
Smarca2 T A 19: 26,682,052 F914Y possibly damaging Het
Spef2 C A 15: 9,653,005 V897L probably benign Het
Spon2 C A 5: 33,216,710 E110* probably null Het
Sstr2 A G 11: 113,624,351 N32S probably benign Het
Stk4 T C 2: 164,118,065 V415A probably benign Het
Tcaf1 T G 6: 42,677,438 T607P probably benign Het
Ush1c C A 7: 46,201,056 L766F probably damaging Het
Usp9y T C Y: 1,383,354 I795V probably benign Het
Vmn1r43 G A 6: 89,869,895 T203M probably damaging Het
Vmn2r53 A G 7: 12,606,304 S81P probably damaging Het
Vps45 A G 3: 96,053,033 probably benign Het
Wdr6 A G 9: 108,574,428 V752A probably benign Het
Xkr4 G A 1: 3,216,135 R611* probably null Het
Zc3h6 T G 2: 129,017,176 Y1042* probably null Het
Zfp236 A G 18: 82,620,344 S1384P possibly damaging Het
Zfp800 A T 6: 28,243,216 N583K probably benign Het
Zpld1 T C 16: 55,241,401 S206G probably benign Het
Zxdc T A 6: 90,372,839 S372R probably damaging Het
Other mutations in Sae1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02206:Sae1 APN 7 16330656 missense possibly damaging 0.94
IGL02672:Sae1 APN 7 16370348 missense probably damaging 1.00
IGL02881:Sae1 APN 7 16359118 missense probably damaging 1.00
R0255:Sae1 UTSW 7 16370322 nonsense probably null
R0667:Sae1 UTSW 7 16368532 missense probably damaging 1.00
R1374:Sae1 UTSW 7 16378408 missense probably damaging 0.97
R1585:Sae1 UTSW 7 16330612 critical splice donor site probably null
R1960:Sae1 UTSW 7 16368565 missense possibly damaging 0.90
R2278:Sae1 UTSW 7 16370366 missense probably damaging 1.00
R5513:Sae1 UTSW 7 16366856 missense probably benign 0.00
R5677:Sae1 UTSW 7 16370462 critical splice acceptor site probably null
R6694:Sae1 UTSW 7 16368536 missense probably damaging 1.00
R6975:Sae1 UTSW 7 16336787 missense probably damaging 0.99
R7307:Sae1 UTSW 7 16368544 nonsense probably null
R7914:Sae1 UTSW 7 16387723 missense unknown
R8437:Sae1 UTSW 7 16370354 missense probably damaging 1.00
Z1177:Sae1 UTSW 7 16327871 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCTTGGAATGCTGGTTAAAGC -3'
(R):5'- AAAGTGTATTGCCTTTCACCTGG -3'

Sequencing Primer
(F):5'- CTGGTTAAAGCACCGGCAG -3'
(R):5'- ACTTCCTATAGGTGAACACAAGAG -3'
Posted On 2021-11-19