Mutagenetix > Incidental Mutation

Incidental Mutation 'R9076:Smarca2'

689827

Institutional Source

Beutler Lab

Gene Symbol

Smarca2

Ensembl Gene

ENSMUSG00000024921

Gene Name

SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2

Synonyms

Snf2l2, brm, 2610209L14Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9076 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

26605050-26778322 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 26682052 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Tyrosine at position 914 (F914Y)

Ref Sequence

ENSEMBL: ENSMUSP00000135784 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025862] [ENSMUST00000099537] [ENSMUST00000176030] [ENSMUST00000176769]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000025862
AA Change: F914Y

PolyPhen 2 Score 0.518 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000025862
Gene: ENSMUSG00000024921
AA Change: F914Y

Domain	Start	End	E-Value	Type
low complexity region	11	58	N/A	INTRINSIC
low complexity region	98	113	N/A	INTRINSIC
low complexity region	135	154	N/A	INTRINSIC
QLQ	172	208	2.58e-13	SMART
low complexity region	216	264	N/A	INTRINSIC
low complexity region	290	314	N/A	INTRINSIC
low complexity region	394	405	N/A	INTRINSIC
HSA	447	519	1.44e-28	SMART
low complexity region	559	579	N/A	INTRINSIC
BRK	601	645	1.9e-19	SMART
DEXDc	731	923	1.34e-36	SMART
Blast:DEXDc	934	966	8e-10	BLAST
low complexity region	1005	1014	N/A	INTRINSIC
HELICc	1091	1175	3.84e-23	SMART
low complexity region	1233	1248	N/A	INTRINSIC
SnAC	1269	1337	7.29e-28	SMART
low complexity region	1344	1366	N/A	INTRINSIC
BROMO	1391	1501	3.13e-41	SMART
low complexity region	1502	1524	N/A	INTRINSIC
low complexity region	1526	1540	N/A	INTRINSIC
low complexity region	1564	1576	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000099537
AA Change: F914Y

PolyPhen 2 Score 0.518 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000097135
Gene: ENSMUSG00000024921
AA Change: F914Y

Domain	Start	End	E-Value	Type
low complexity region	11	58	N/A	INTRINSIC
low complexity region	98	113	N/A	INTRINSIC
low complexity region	135	154	N/A	INTRINSIC
QLQ	172	208	2.58e-13	SMART
low complexity region	216	264	N/A	INTRINSIC
low complexity region	290	314	N/A	INTRINSIC
low complexity region	394	405	N/A	INTRINSIC
HSA	447	519	1.44e-28	SMART
low complexity region	559	579	N/A	INTRINSIC
BRK	601	645	1.9e-19	SMART
DEXDc	731	923	1.34e-36	SMART
Blast:DEXDc	934	966	7e-10	BLAST
low complexity region	1005	1014	N/A	INTRINSIC
HELICc	1091	1175	3.84e-23	SMART
low complexity region	1233	1248	N/A	INTRINSIC
SnAC	1269	1337	7.29e-28	SMART
low complexity region	1344	1366	N/A	INTRINSIC
PDB:2DAT\|A	1389	1410	1e-6	PDB
low complexity region	1480	1508	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000176030
AA Change: F914Y

PolyPhen 2 Score 0.518 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000135784
Gene: ENSMUSG00000024921
AA Change: F914Y

Domain	Start	End	E-Value	Type
low complexity region	11	58	N/A	INTRINSIC
low complexity region	98	113	N/A	INTRINSIC
low complexity region	135	154	N/A	INTRINSIC
QLQ	172	208	2.58e-13	SMART
low complexity region	216	264	N/A	INTRINSIC
low complexity region	290	314	N/A	INTRINSIC
low complexity region	394	405	N/A	INTRINSIC
HSA	447	519	1.44e-28	SMART
low complexity region	559	579	N/A	INTRINSIC
BRK	601	645	1.9e-19	SMART
DEXDc	731	923	1.34e-36	SMART
Blast:DEXDc	934	966	8e-10	BLAST
low complexity region	1005	1014	N/A	INTRINSIC
HELICc	1091	1175	3.84e-23	SMART
low complexity region	1233	1248	N/A	INTRINSIC
SnAC	1269	1337	7.29e-28	SMART
low complexity region	1344	1366	N/A	INTRINSIC
BROMO	1391	1519	1.74e-39	SMART
low complexity region	1520	1542	N/A	INTRINSIC
low complexity region	1544	1558	N/A	INTRINSIC
low complexity region	1582	1594	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000176769

SMART Domains

Protein: ENSMUSP00000135017
Gene: ENSMUSG00000024921

Domain	Start	End	E-Value	Type
low complexity region	11	58	N/A	INTRINSIC
low complexity region	98	113	N/A	INTRINSIC
low complexity region	135	154	N/A	INTRINSIC
QLQ	172	208	2.58e-13	SMART
low complexity region	216	264	N/A	INTRINSIC
low complexity region	290	314	N/A	INTRINSIC
low complexity region	394	405	N/A	INTRINSIC
HSA	447	519	1.44e-28	SMART
low complexity region	559	579	N/A	INTRINSIC
BRK	601	645	1.9e-19	SMART
DEXDc	731	908	4.18e-24	SMART
low complexity region	947	956	N/A	INTRINSIC
HELICc	1033	1117	3.84e-23	SMART
low complexity region	1175	1190	N/A	INTRINSIC
SnAC	1211	1279	7.29e-28	SMART
low complexity region	1286	1308	N/A	INTRINSIC
BROMO	1333	1443	3.13e-41	SMART
low complexity region	1444	1466	N/A	INTRINSIC
low complexity region	1468	1482	N/A	INTRINSIC
low complexity region	1506	1518	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000208303

Meta Mutation Damage Score

0.3108

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

99% (67/68)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SWI/SNF family of proteins and is highly similar to the brahma protein of Drosophila. Members of this family have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein is part of the large ATP-dependent chromatin remodeling complex SNF/SWI, which is required for transcriptional activation of genes normally repressed by chromatin. Alternatively spliced transcript variants encoding different isoforms have been found for this gene, which contains a trinucleotide repeat (CAG) length polymorphism. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a targeted mutation in this gene may exhibit infertility and a slightly increased body weight in some genetic backgrounds. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adcy7	G	A	8: 88,327,708	G1064R	probably damaging	Het
Adcy9	A	G	16: 4,288,823	V1046A	probably damaging	Het
Adgrv1	C	T	13: 81,422,128		probably null	Het
Apbb2	A	C	5: 66,312,164	L554W	probably damaging	Het
Arhgef10	C	T	8: 14,974,993	P722S	probably damaging	Het
Capns1	A	C	7: 30,194,085	M1R	probably null	Het
Chst1	C	T	2: 92,613,416	Q78*	probably null	Het
Clec12b	A	G	6: 129,379,617	S195P	possibly damaging	Het
Cog8	C	T	8: 107,052,576	M356I	probably damaging	Het
Cyp4b1	T	C	4: 115,625,227	N452D	probably damaging	Het
Defb40	A	T	8: 18,974,978	Y71N	probably benign	Het
Dhx8	G	T	11: 101,738,195	R190L		Het
Disp1	G	A	1: 183,087,235	T1207M	possibly damaging	Het
Dnah9	T	A	11: 66,117,638	Y787F	probably benign	Het
Egflam	T	C	15: 7,207,674	N1010D	probably damaging	Het
Fam151a	T	A	4: 106,746,057	Y272N	probably damaging	Het
Fat1	T	C	8: 45,039,901	Y3887H	probably damaging	Het
Fpr3	T	A	17: 17,971,463	I332N	probably benign	Het
Frmd4a	G	T	2: 4,603,954	G878W	probably damaging	Het
Fv1	T	C	4: 147,869,171	Y65H	possibly damaging	Het
Gabra6	G	A	11: 42,307,462	A387V	probably benign	Het
Gm34653	A	T	2: 34,839,197	Y336F	probably damaging	Het
Gna11	T	C	10: 81,530,881	T332A		Het
Gpr161	T	A	1: 165,306,188	H6Q	possibly damaging	Het
Grin2b	CA	C	6: 135,732,511		probably null	Het
Heatr3	A	T	8: 88,150,199	M290L	probably benign	Het
Ifi47	T	G	11: 49,096,015	I203R	probably benign	Het
Ighv5-8	TATACAT	TAT	12: 113,654,963		probably benign	Het
Klhl10	A	G	11: 100,447,136	M234V	possibly damaging	Het
Klra4	A	G	6: 130,062,144	I95T	possibly damaging	Het
Krt84	A	G	15: 101,529,663	F286L	probably damaging	Het
Lrp2	A	G	2: 69,519,916	V704A	probably benign	Het
Lypd6b	A	T	2: 49,947,522	S169C	possibly damaging	Het
Mapk12	T	C	15: 89,140,408	E22G	probably benign	Het
Ncapg	T	C	5: 45,676,641	C340R	probably benign	Het
Ncor2	A	G	5: 125,034,022	L394P		Het
Nek1	T	G	8: 61,028,734	S228A	probably damaging	Het
Olfr1224-ps1	C	T	2: 89,156,375	E267K	possibly damaging	Het
Olfr314	T	A	11: 58,786,733	F166L	possibly damaging	Het
Olfr320	T	C	11: 58,683,896	C8R	probably benign	Het
Olfr329-ps	A	T	11: 58,542,956	C186*	probably null	Het
Olfr657	C	T	7: 104,636,084	R137C	probably benign	Het
Pcdha8	C	A	18: 36,993,232	P256T	possibly damaging	Het
Pmm1	C	T	15: 81,955,695	R143H	probably damaging	Het
Ptprn	A	T	1: 75,252,374	M799K	probably damaging	Het
Rhpn2	A	T	7: 35,384,048		probably benign	Het
Sae1	A	G	7: 16,336,743	F281L	probably benign	Het
Slc25a23	A	G	17: 57,047,309	Y366H	probably benign	Het
Slc25a25	G	T	2: 32,419,163	T222K	probably damaging	Het
Spef2	C	A	15: 9,653,005	V897L	probably benign	Het
Spon2	C	A	5: 33,216,710	E110*	probably null	Het
Sstr2	A	G	11: 113,624,351	N32S	probably benign	Het
Stk4	T	C	2: 164,118,065	V415A	probably benign	Het
Tcaf1	T	G	6: 42,677,438	T607P	probably benign	Het
Ush1c	C	A	7: 46,201,056	L766F	probably damaging	Het
Usp9y	T	C	Y: 1,383,354	I795V	probably benign	Het
Vmn1r43	G	A	6: 89,869,895	T203M	probably damaging	Het
Vmn2r53	A	G	7: 12,606,304	S81P	probably damaging	Het
Vps45	A	G	3: 96,053,033		probably benign	Het
Wdr6	A	G	9: 108,574,428	V752A	probably benign	Het
Xkr4	G	A	1: 3,216,135	R611*	probably null	Het
Zc3h6	T	G	2: 129,017,176	Y1042*	probably null	Het
Zfp236	A	G	18: 82,620,344	S1384P	possibly damaging	Het
Zfp800	A	T	6: 28,243,216	N583K	probably benign	Het
Zpld1	T	C	16: 55,241,401	S206G	probably benign	Het
Zxdc	T	A	6: 90,372,839	S372R	probably damaging	Het

Other mutations in Smarca2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01368:Smarca2	APN	19	26774294	missense	possibly damaging	0.82
IGL01907:Smarca2	APN	19	26698465	missense	possibly damaging	0.59
IGL02039:Smarca2	APN	19	26716137	missense	probably damaging	1.00
IGL02110:Smarca2	APN	19	26672740	missense	possibly damaging	0.96
IGL02561:Smarca2	APN	19	26716182	missense	possibly damaging	0.92
IGL02649:Smarca2	APN	19	26640586	missense	possibly damaging	0.73
IGL02880:Smarca2	APN	19	26676624	splice site	probably benign
IGL03028:Smarca2	APN	19	26678312	splice site	probably benign
IGL03187:Smarca2	APN	19	26672824	missense	probably damaging	0.98
IGL03213:Smarca2	APN	19	26623975	missense	probably damaging	1.00
IGL03354:Smarca2	APN	19	26619903	missense	probably benign	0.01
Genghis	UTSW	19	26619884	missense	possibly damaging	0.53
kraft	UTSW	19	26678363	missense	probably damaging	0.99
Kublai	UTSW	19	26640613	missense	probably damaging	1.00
Samarkand	UTSW	19	26654464	nonsense	probably null
tashkent	UTSW	19	26720873	missense	probably benign	0.06
Xanadu	UTSW	19	26682052	missense	possibly damaging	0.52
FR4737:Smarca2	UTSW	19	26630999	unclassified	probably benign
PIT1430001:Smarca2	UTSW	19	26649093	missense	probably benign	0.35
R0184:Smarca2	UTSW	19	26692249	nonsense	probably null
R0306:Smarca2	UTSW	19	26640613	missense	probably damaging	1.00
R0538:Smarca2	UTSW	19	26691362	missense	probably damaging	0.99
R0565:Smarca2	UTSW	19	26681875	missense	possibly damaging	0.71
R0610:Smarca2	UTSW	19	26691391	missense	probably damaging	1.00
R0669:Smarca2	UTSW	19	26706200	missense	possibly damaging	0.51
R0726:Smarca2	UTSW	19	26698403	missense	probably damaging	1.00
R1184:Smarca2	UTSW	19	26770933	splice site	probably benign
R1256:Smarca2	UTSW	19	26681973	missense	probably benign	0.06
R1299:Smarca2	UTSW	19	26771611	critical splice donor site	probably null
R1306:Smarca2	UTSW	19	26770988	missense	possibly damaging	0.81
R1381:Smarca2	UTSW	19	26630828	missense	probably damaging	1.00
R1400:Smarca2	UTSW	19	26676740	missense	probably damaging	0.98
R1415:Smarca2	UTSW	19	26710684	missense	probably null	0.72
R1496:Smarca2	UTSW	19	26631101	missense	possibly damaging	0.85
R1582:Smarca2	UTSW	19	26751905	missense	probably damaging	0.99
R1666:Smarca2	UTSW	19	26647034	missense	possibly damaging	0.65
R1668:Smarca2	UTSW	19	26647034	missense	possibly damaging	0.65
R1751:Smarca2	UTSW	19	26640380	splice site	probably benign
R1861:Smarca2	UTSW	19	26623884	missense	probably benign	0.03
R1962:Smarca2	UTSW	19	26672724	nonsense	probably null
R1964:Smarca2	UTSW	19	26672724	nonsense	probably null
R1998:Smarca2	UTSW	19	26631093	missense	probably benign	0.33
R2014:Smarca2	UTSW	19	26683905	missense	possibly damaging	0.86
R2255:Smarca2	UTSW	19	26771038	missense	probably benign	0.01
R2392:Smarca2	UTSW	19	26640650	critical splice donor site	probably null
R2439:Smarca2	UTSW	19	26691454	critical splice donor site	probably null
R3030:Smarca2	UTSW	19	26752029	missense	possibly damaging	0.84
R3195:Smarca2	UTSW	19	26683822	missense	possibly damaging	0.85
R3430:Smarca2	UTSW	19	26691349	missense	probably damaging	1.00
R3710:Smarca2	UTSW	19	26668890	unclassified	probably benign
R3845:Smarca2	UTSW	19	26720873	missense	probably benign	0.06
R4013:Smarca2	UTSW	19	26683927	splice site	probably null
R4014:Smarca2	UTSW	19	26683927	splice site	probably null
R4016:Smarca2	UTSW	19	26683927	splice site	probably null
R4271:Smarca2	UTSW	19	26720949	critical splice donor site	probably null
R4471:Smarca2	UTSW	19	26619877	missense	possibly damaging	0.86
R4612:Smarca2	UTSW	19	26776225	missense	possibly damaging	0.70
R4730:Smarca2	UTSW	19	26630673	missense	probably damaging	1.00
R4755:Smarca2	UTSW	19	26654483	missense	possibly damaging	0.86
R4999:Smarca2	UTSW	19	26720855	nonsense	probably null
R5015:Smarca2	UTSW	19	26691388	missense	possibly damaging	0.86
R5320:Smarca2	UTSW	19	26691372	missense	probably damaging	1.00
R5393:Smarca2	UTSW	19	26640429	missense	probably benign	0.18
R5503:Smarca2	UTSW	19	26623936	missense	probably damaging	0.96
R5503:Smarca2	UTSW	19	26682046	missense	possibly damaging	0.93
R5715:Smarca2	UTSW	19	26649122	missense	probably benign	0.16
R5790:Smarca2	UTSW	19	26676724	missense	probably damaging	1.00
R5874:Smarca2	UTSW	19	26776069	intron	probably benign
R6209:Smarca2	UTSW	19	26771004	nonsense	probably null
R6236:Smarca2	UTSW	19	26696213	missense	probably benign	0.33
R6291:Smarca2	UTSW	19	26630892	missense	probably damaging	1.00
R6292:Smarca2	UTSW	19	26630892	missense	probably damaging	1.00
R6325:Smarca2	UTSW	19	26678363	missense	probably damaging	0.99
R6544:Smarca2	UTSW	19	26630931	missense	probably damaging	1.00
R6572:Smarca2	UTSW	19	26679173	missense	possibly damaging	0.71
R6589:Smarca2	UTSW	19	26619884	missense	possibly damaging	0.53
R6601:Smarca2	UTSW	19	26654377	missense	probably benign	0.30
R6804:Smarca2	UTSW	19	26751886	missense	possibly damaging	0.93
R6922:Smarca2	UTSW	19	26691349	missense	probably damaging	1.00
R7047:Smarca2	UTSW	19	26669155	missense	possibly damaging	0.83
R7213:Smarca2	UTSW	19	26647131	missense	possibly damaging	0.96
R7257:Smarca2	UTSW	19	26654464	nonsense	probably null
R7259:Smarca2	UTSW	19	26654464	nonsense	probably null
R7479:Smarca2	UTSW	19	26640487	missense	probably benign	0.00
R7512:Smarca2	UTSW	19	26683809	missense	possibly damaging	0.51
R8158:Smarca2	UTSW	19	26682048	missense	probably benign	0.16
R8182:Smarca2	UTSW	19	26630720	missense	probably benign	0.39
R8207:Smarca2	UTSW	19	26676680	missense	possibly damaging	0.71
R8467:Smarca2	UTSW	19	26619721	start codon destroyed	probably null	0.02
R8527:Smarca2	UTSW	19	26676787	missense	probably damaging	0.98
R8784:Smarca2	UTSW	19	26776158	missense	probably benign	0.17
R8898:Smarca2	UTSW	19	26630958	unclassified	probably benign
R9123:Smarca2	UTSW	19	26716183	missense	possibly damaging	0.84
R9125:Smarca2	UTSW	19	26716183	missense	possibly damaging	0.84
R9317:Smarca2	UTSW	19	26759879	missense	possibly damaging	0.75
R9501:Smarca2	UTSW	19	26640577	missense	probably benign	0.04
R9514:Smarca2	UTSW	19	26682052	missense	possibly damaging	0.71
R9641:Smarca2	UTSW	19	26679098	missense	possibly damaging	0.93
RF001:Smarca2	UTSW	19	26630986	unclassified	probably benign
RF001:Smarca2	UTSW	19	26631021	unclassified	probably benign
RF004:Smarca2	UTSW	19	26631020	unclassified	probably benign
RF019:Smarca2	UTSW	19	26631001	unclassified	probably benign
RF021:Smarca2	UTSW	19	26630997	unclassified	probably benign
RF024:Smarca2	UTSW	19	26631020	unclassified	probably benign
RF034:Smarca2	UTSW	19	26631011	unclassified	probably benign
RF040:Smarca2	UTSW	19	26631022	unclassified	probably benign
RF041:Smarca2	UTSW	19	26631021	unclassified	probably benign
RF047:Smarca2	UTSW	19	26631005	unclassified	probably benign
RF051:Smarca2	UTSW	19	26630988	unclassified	probably benign
X0061:Smarca2	UTSW	19	26720840	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- TGGAAGCCACTGTACGTCTG -3'
(R):5'- GTAGTCCGGAGTTTTCACTTCC -3'

Sequencing Primer
(F):5'- CCTGCAGATTCGGTGGAAGTAC -3'
(R):5'- GGAGTTTTCACTTCCTCATCACAAAG -3'

Posted On

2021-11-19