Incidental Mutation 'R9077:Arfgef3'
ID 689855
Institutional Source Beutler Lab
Gene Symbol Arfgef3
Ensembl Gene ENSMUSG00000019852
Gene Name ARFGEF family member 3
Synonyms B930094H20Rik, D10Bwg1379e, BIG3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock # R9077 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 18581839-18743949 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 18625151 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 1117 (D1117G)
Ref Sequence ENSEMBL: ENSMUSP00000149210 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019999] [ENSMUST00000215836]
AlphaFold Q3UGY8
Predicted Effect probably damaging
Transcript: ENSMUST00000019999
AA Change: D1117G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000019999
Gene: ENSMUSG00000019852
AA Change: D1117G

DomainStartEndE-ValueType
Pfam:DCB 1 170 7.1e-15 PFAM
low complexity region 236 245 N/A INTRINSIC
low complexity region 276 295 N/A INTRINSIC
low complexity region 452 462 N/A INTRINSIC
Sec7 582 794 6e-54 SMART
Blast:Sec7 798 873 3e-20 BLAST
low complexity region 927 940 N/A INTRINSIC
Pfam:DUF1981 1237 1312 1.9e-14 PFAM
low complexity region 1641 1652 N/A INTRINSIC
low complexity region 1710 1723 N/A INTRINSIC
low complexity region 1838 1856 N/A INTRINSIC
low complexity region 2088 2099 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000215836
AA Change: D1117G

PolyPhen 2 Score 0.809 (Sensitivity: 0.84; Specificity: 0.93)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.5%
Validation Efficiency 100% (48/48)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased insulin granule biogenesis and insulin secretion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam8 A G 7: 139,987,639 V397A probably benign Het
AF067063 T C 13: 119,828,349 M104V probably benign Het
Alkbh3 A G 2: 93,981,580 V235A probably damaging Het
Arfgef2 A G 2: 166,864,801 I982V probably damaging Het
Arhgap31 G T 16: 38,602,368 A1112D probably damaging Het
Arhgef4 T C 1: 34,721,743 C27R unknown Het
Bzw1 T A 1: 58,399,031 M90K probably benign Het
C330027C09Rik A G 16: 49,007,148 I459V probably benign Het
Cdk17 T C 10: 93,232,415 Y345H probably damaging Het
Cog8 C T 8: 107,052,576 M356I probably damaging Het
Ctsw T C 19: 5,466,403 D173G probably benign Het
Dnah6 A T 6: 73,144,046 C1488* probably null Het
Dnah7a T C 1: 53,702,059 K13E unknown Het
Eif3f A G 7: 108,940,218 M232V probably benign Het
Gk5 C A 9: 96,119,581 T44K probably benign Het
Glrb A G 3: 80,855,910 F260S probably damaging Het
Glyctk C A 9: 106,155,323 R497L probably benign Het
Gm10153 G T 7: 142,189,646 C248* probably null Het
Hand2 A G 8: 57,323,801 K199E probably damaging Het
Heatr1 T A 13: 12,413,366 C795S probably benign Het
Il31ra T C 13: 112,533,827 I342M probably benign Het
Itm2b G T 14: 73,368,425 D40E probably benign Het
Ksr1 T C 11: 79,036,726 T371A probably damaging Het
Lctl C A 9: 64,131,959 probably benign Het
Lpin1 G A 12: 16,541,746 P827S Het
Lyst T C 13: 13,683,108 I2494T probably benign Het
Mia2 A G 12: 59,179,974 N510S possibly damaging Het
Mycbp2 T C 14: 103,232,538 D1308G probably damaging Het
Naip2 C T 13: 100,154,951 D1160N probably benign Het
Naip2 T C 13: 100,154,960 S1157G probably benign Het
Olfr531 G A 7: 140,400,896 P50L probably benign Het
Olfr657 C T 7: 104,636,084 R137C probably benign Het
Olfr657 A G 7: 104,636,411 T246A probably damaging Het
Omt2b T C 9: 78,328,266 probably null Het
Pan2 A G 10: 128,312,987 Y490C probably damaging Het
Pard6g A G 18: 80,117,557 E295G probably damaging Het
Pcdhb8 T C 18: 37,356,361 V23A probably damaging Het
Phactr3 A T 2: 178,332,965 probably benign Het
Pip G A 6: 41,851,454 S74N probably damaging Het
Plau G A 14: 20,839,881 E265K probably benign Het
Pmm1 C T 15: 81,955,695 R143H probably damaging Het
Rcor3 C T 1: 192,123,565 D230N probably damaging Het
Siglec15 A G 18: 78,048,768 Y73H possibly damaging Het
Spag16 T A 1: 70,493,771 probably benign Het
Spta1 G T 1: 174,217,604 D1506Y probably damaging Het
Tacr3 A T 3: 134,929,950 Y305F probably benign Het
Vmn1r83 G A 7: 12,321,644 T162M probably damaging Het
Vmn2r116 G T 17: 23,385,982 D90Y probably benign Het
Wdr76 A G 2: 121,534,127 N304S probably benign Het
Wee1 G A 7: 110,126,756 V358I probably damaging Het
Zan G A 5: 137,403,206 P4084S unknown Het
Other mutations in Arfgef3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00769:Arfgef3 APN 10 18660604 missense probably benign 0.03
IGL00835:Arfgef3 APN 10 18661358 missense probably benign
IGL00961:Arfgef3 APN 10 18611237 missense probably damaging 1.00
IGL01400:Arfgef3 APN 10 18652706 missense probably damaging 1.00
IGL01501:Arfgef3 APN 10 18600560 missense possibly damaging 0.93
IGL01595:Arfgef3 APN 10 18594912 missense possibly damaging 0.93
IGL01695:Arfgef3 APN 10 18603419 missense probably benign 0.00
IGL01774:Arfgef3 APN 10 18743615 missense possibly damaging 0.94
IGL02348:Arfgef3 APN 10 18591347 missense probably benign 0.04
IGL02371:Arfgef3 APN 10 18646539 missense probably benign
IGL02400:Arfgef3 APN 10 18646257 missense probably damaging 1.00
IGL02630:Arfgef3 APN 10 18661392 splice site probably benign
IGL02815:Arfgef3 APN 10 18652551 missense probably damaging 1.00
IGL03178:Arfgef3 APN 10 18613225 missense probably damaging 1.00
IGL03182:Arfgef3 APN 10 18600544 missense probably damaging 1.00
IGL03267:Arfgef3 APN 10 18591882 missense probably damaging 1.00
IGL03294:Arfgef3 APN 10 18664912 missense probably damaging 0.97
IGL03410:Arfgef3 APN 10 18600490 missense probably damaging 1.00
Bow-wow UTSW 10 18646730 nonsense probably null
R0098:Arfgef3 UTSW 10 18589642 missense probably damaging 1.00
R0098:Arfgef3 UTSW 10 18589642 missense probably damaging 1.00
R0141:Arfgef3 UTSW 10 18597407 missense probably damaging 1.00
R0164:Arfgef3 UTSW 10 18647915 missense possibly damaging 0.77
R0164:Arfgef3 UTSW 10 18647915 missense possibly damaging 0.77
R0241:Arfgef3 UTSW 10 18599214 missense probably damaging 1.00
R0334:Arfgef3 UTSW 10 18592281 missense probably damaging 0.98
R0352:Arfgef3 UTSW 10 18661387 missense probably benign 0.17
R0415:Arfgef3 UTSW 10 18613127 splice site probably benign
R0417:Arfgef3 UTSW 10 18603511 missense probably damaging 1.00
R0442:Arfgef3 UTSW 10 18677815 splice site probably benign
R0507:Arfgef3 UTSW 10 18591621 missense probably damaging 1.00
R0573:Arfgef3 UTSW 10 18599288 missense probably damaging 1.00
R0582:Arfgef3 UTSW 10 18611290 missense probably damaging 1.00
R0609:Arfgef3 UTSW 10 18597431 missense probably benign 0.31
R0826:Arfgef3 UTSW 10 18589666 missense probably damaging 0.98
R0919:Arfgef3 UTSW 10 18589735 missense possibly damaging 0.89
R0980:Arfgef3 UTSW 10 18592118 missense possibly damaging 0.82
R1027:Arfgef3 UTSW 10 18591375 missense probably benign 0.02
R1140:Arfgef3 UTSW 10 18597348 missense possibly damaging 0.77
R1491:Arfgef3 UTSW 10 18646554 missense probably damaging 1.00
R1493:Arfgef3 UTSW 10 18630879 missense probably damaging 0.96
R1529:Arfgef3 UTSW 10 18613222 nonsense probably null
R1564:Arfgef3 UTSW 10 18591704 missense probably damaging 1.00
R1654:Arfgef3 UTSW 10 18625148 missense probably null 0.15
R1868:Arfgef3 UTSW 10 18661387 missense probably benign 0.17
R1876:Arfgef3 UTSW 10 18597356 missense probably damaging 1.00
R1908:Arfgef3 UTSW 10 18652763 missense possibly damaging 0.80
R2211:Arfgef3 UTSW 10 18592245 missense possibly damaging 0.54
R2316:Arfgef3 UTSW 10 18616953 missense probably benign 0.19
R2393:Arfgef3 UTSW 10 18597787 missense possibly damaging 0.88
R2407:Arfgef3 UTSW 10 18677866 missense possibly damaging 0.63
R3076:Arfgef3 UTSW 10 18603530 missense probably damaging 0.99
R3077:Arfgef3 UTSW 10 18603530 missense probably damaging 0.99
R3963:Arfgef3 UTSW 10 18592277 missense probably damaging 1.00
R4201:Arfgef3 UTSW 10 18619782 missense probably benign 0.01
R4241:Arfgef3 UTSW 10 18625164 missense probably damaging 1.00
R4244:Arfgef3 UTSW 10 18630420 missense probably damaging 1.00
R4395:Arfgef3 UTSW 10 18597709 missense probably damaging 1.00
R4455:Arfgef3 UTSW 10 18607675 missense probably benign 0.18
R4480:Arfgef3 UTSW 10 18600600 missense probably damaging 1.00
R4499:Arfgef3 UTSW 10 18608343 missense possibly damaging 0.95
R4589:Arfgef3 UTSW 10 18646199 missense probably damaging 1.00
R4635:Arfgef3 UTSW 10 18634855 missense probably damaging 1.00
R4776:Arfgef3 UTSW 10 18654247 missense probably benign
R4801:Arfgef3 UTSW 10 18591906 missense probably benign 0.00
R4802:Arfgef3 UTSW 10 18591906 missense probably benign 0.00
R4807:Arfgef3 UTSW 10 18646637 missense probably benign
R4828:Arfgef3 UTSW 10 18652693 missense probably damaging 0.99
R4861:Arfgef3 UTSW 10 18607731 missense probably benign 0.01
R4861:Arfgef3 UTSW 10 18607731 missense probably benign 0.01
R4917:Arfgef3 UTSW 10 18616890 missense probably damaging 0.99
R4918:Arfgef3 UTSW 10 18616890 missense probably damaging 0.99
R4922:Arfgef3 UTSW 10 18592186 missense probably damaging 0.97
R4929:Arfgef3 UTSW 10 18630851 missense probably benign 0.00
R4937:Arfgef3 UTSW 10 18589706 missense probably damaging 0.98
R5290:Arfgef3 UTSW 10 18600460 missense probably damaging 1.00
R5410:Arfgef3 UTSW 10 18611237 missense probably damaging 0.99
R5807:Arfgef3 UTSW 10 18647798 splice site probably null
R5832:Arfgef3 UTSW 10 18630420 missense probably damaging 1.00
R5887:Arfgef3 UTSW 10 18607665 nonsense probably null
R6272:Arfgef3 UTSW 10 18646963 missense probably benign 0.00
R6302:Arfgef3 UTSW 10 18652841 missense probably damaging 0.97
R6397:Arfgef3 UTSW 10 18607665 nonsense probably null
R6495:Arfgef3 UTSW 10 18611202 critical splice donor site probably null
R6707:Arfgef3 UTSW 10 18621155 missense probably benign 0.11
R6814:Arfgef3 UTSW 10 18595019 missense probably damaging 1.00
R6830:Arfgef3 UTSW 10 18664889 critical splice donor site probably null
R6870:Arfgef3 UTSW 10 18646730 nonsense probably null
R6941:Arfgef3 UTSW 10 18625455 missense possibly damaging 0.66
R7094:Arfgef3 UTSW 10 18646439 missense probably damaging 1.00
R7179:Arfgef3 UTSW 10 18599267 missense probably damaging 1.00
R7204:Arfgef3 UTSW 10 18646462 missense probably damaging 1.00
R7247:Arfgef3 UTSW 10 18625391 missense probably benign 0.00
R7249:Arfgef3 UTSW 10 18630835 missense possibly damaging 0.62
R7318:Arfgef3 UTSW 10 18630463 missense possibly damaging 0.89
R7391:Arfgef3 UTSW 10 18646259 missense probably benign 0.05
R7527:Arfgef3 UTSW 10 18646629 missense probably benign
R7618:Arfgef3 UTSW 10 18646281 missense probably damaging 1.00
R7779:Arfgef3 UTSW 10 18595023 missense probably damaging 0.99
R7851:Arfgef3 UTSW 10 18592286 missense probably damaging 1.00
R8112:Arfgef3 UTSW 10 18652631 missense possibly damaging 0.96
R8133:Arfgef3 UTSW 10 18611203 critical splice donor site probably null
R8242:Arfgef3 UTSW 10 18630076 missense probably benign 0.25
R8369:Arfgef3 UTSW 10 18589729 missense probably benign 0.34
R8396:Arfgef3 UTSW 10 18652532 critical splice donor site probably null
R8553:Arfgef3 UTSW 10 18603530 missense probably damaging 0.99
R8798:Arfgef3 UTSW 10 18647051 missense probably damaging 1.00
R8821:Arfgef3 UTSW 10 18652743 missense possibly damaging 0.95
R8831:Arfgef3 UTSW 10 18652743 missense possibly damaging 0.95
R8918:Arfgef3 UTSW 10 18635705 missense probably benign 0.01
R8929:Arfgef3 UTSW 10 18603455 missense probably damaging 1.00
R9001:Arfgef3 UTSW 10 18646728 missense probably benign 0.32
R9258:Arfgef3 UTSW 10 18589639 missense probably damaging 1.00
R9267:Arfgef3 UTSW 10 18599280 missense probably damaging 1.00
R9358:Arfgef3 UTSW 10 18616880 missense probably damaging 1.00
R9388:Arfgef3 UTSW 10 18630129 missense probably benign 0.35
R9389:Arfgef3 UTSW 10 18603523 missense probably damaging 1.00
R9563:Arfgef3 UTSW 10 18646527 missense probably damaging 1.00
R9713:Arfgef3 UTSW 10 18652808 missense probably damaging 1.00
X0026:Arfgef3 UTSW 10 18652626 missense probably damaging 1.00
Z1176:Arfgef3 UTSW 10 18591437 missense probably damaging 1.00
Z1176:Arfgef3 UTSW 10 18608358 missense probably damaging 0.97
Z1176:Arfgef3 UTSW 10 18634852 missense probably benign 0.26
Z1177:Arfgef3 UTSW 10 18607776 missense probably damaging 1.00
Z1177:Arfgef3 UTSW 10 18627628 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTCAGGCATTAGAGGATGGTTTG -3'
(R):5'- TGGCCTCCTTGGGGAAATTG -3'

Sequencing Primer
(F):5'- GCCAGCCTAGCTTACTTGATAAG -3'
(R):5'- TGAGTTTAAGAGCTCATCCCAGG -3'
Posted On 2021-11-19