Incidental Mutation 'R9080:Vmn2r72'
ID689959
Institutional Source Beutler Lab
Gene Symbol Vmn2r72
Ensembl Gene ENSMUSG00000051877
Gene Namevomeronasal 2, receptor 72
SynonymsVmn2r72-ps, EG244114
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R9080 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location85737784-85754981 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 85738256 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Serine at position 700 (I700S)
Ref Sequence ENSEMBL: ENSMUSP00000133014 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063425]
AlphaFold D3Z4N8
Predicted Effect probably damaging
Transcript: ENSMUST00000063425
AA Change: I700S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133014
Gene: ENSMUSG00000051877
AA Change: I700S

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 82 469 2.3e-28 PFAM
Pfam:NCD3G 512 564 1.2e-18 PFAM
Pfam:7tm_3 594 832 4e-53 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730596B20Rik T C 6: 52,178,993 I13T unknown Het
Adad1 G T 3: 37,065,249 V160L probably benign Het
Adamts6 T A 13: 104,312,919 M279K probably damaging Het
Adgra2 T C 8: 27,114,501 S535P probably benign Het
Akr1c13 C T 13: 4,191,173 probably benign Het
Anapc1 A G 2: 128,622,506 I1690T possibly damaging Het
Ccdc138 A G 10: 58,562,062 M575V probably damaging Het
Cfap100 T C 6: 90,406,201 N330S unknown Het
Col12a1 T C 9: 79,609,851 D2849G probably benign Het
Cox11 G A 11: 90,644,420 M232I probably damaging Het
Cpne7 C T 8: 123,130,212 P402L probably damaging Het
Cspp1 G A 1: 10,113,694 S848N probably benign Het
Cxcr5 A G 9: 44,513,266 S365P probably damaging Het
Dclre1c A T 2: 3,457,552 M389L probably benign Het
Dlc1 T C 8: 36,584,852 D124G probably benign Het
Dtx3 A T 10: 127,191,268 S346T possibly damaging Het
E330021D16Rik T A 6: 136,400,722 D370V probably damaging Het
Exosc10 A G 4: 148,564,664 D337G probably damaging Het
Fpr1 G A 17: 17,876,950 A259V probably benign Het
Gm11232 A T 4: 71,757,833 M25K probably benign Het
Gm4950 A G 18: 51,865,850 V11A possibly damaging Het
Gsap C T 5: 21,194,412 T37I possibly damaging Het
Igfbp2 T A 1: 72,851,998 C252S probably damaging Het
Ing2 T C 8: 47,668,773 T247A possibly damaging Het
Ints1 C T 5: 139,753,545 V2028M probably benign Het
Itfg1 A G 8: 85,740,245 F400L possibly damaging Het
Itga6 A G 2: 71,843,289 Y889C probably benign Het
Kcnh3 A G 15: 99,241,786 E882G probably damaging Het
Limch1 T A 5: 67,017,649 C515S probably benign Het
Lrrc74a G T 12: 86,749,134 V294F possibly damaging Het
Megf8 A G 7: 25,341,706 E1120G probably damaging Het
Nbea A T 3: 56,005,095 Y1090* probably null Het
Nckap1 A G 2: 80,520,382 Y794H probably damaging Het
Nfib T C 4: 82,705,517 M25V Het
Ogfod2 A G 5: 124,114,944 E339G probably damaging Het
Olah T A 2: 3,348,352 E64V probably damaging Het
Olfr237-ps1 T A 6: 43,153,896 V197D possibly damaging Het
Olfr460 T A 6: 40,571,629 L81H probably damaging Het
Pdcd6ip T A 9: 113,691,556 K120M probably damaging Het
Pex1 A G 5: 3,605,476 I134V probably damaging Het
Plekhm2 T C 4: 141,631,728 H576R probably damaging Het
Ptpn13 T A 5: 103,489,628 H127Q probably damaging Het
Rmnd5b C T 11: 51,624,228 probably null Het
Rsf1 A AAGGCGACGG 7: 97,579,904 probably null Het
Sec16b C A 1: 157,565,730 Q995K probably benign Het
Serpinb6d T A 13: 33,671,124 S260R probably benign Het
Slc47a1 C T 11: 61,373,393 G67S possibly damaging Het
Slco6d1 T C 1: 98,421,258 V18A probably benign Het
Tfcp2 GGTAATCCAAAGAGATGGACTGGTGGCTGTCCTGCTGCTGAGTAATCCAAAGAGATGGACTGGTGGCTGTCCTGCTGCTGAGTAATCCAAAGAGATGGACTGGTGGCTGTCCTGCTGCTGAGTAATCCAAAGAGATGGACTGGTGGCTGTCCTGCTGCTGA GGTAATCCAAAGAGATGGACTGGTGGCTGTCCTGCTGCTGAGTAATCCAAAGAGATGGACTGGTGGCTGTCCTGCTGCTGAGTAATCCAAAGAGATGGACTGGTGGCTGTCCTGCTGCTGA 15: 100,498,087 probably null Het
Tiam2 T G 17: 3,414,244 C83G probably benign Het
Tln2 C T 9: 67,346,561 G743R probably damaging Het
Tmem136 C T 9: 43,111,369 R230Q probably benign Het
Tnks CCCGCCGCCGCCGCCGCCGCCG CCCGCCGCCGCCGCCGCCG 8: 34,965,312 probably benign Het
Ttn G A 2: 76,706,499 T34994I probably benign Het
Uggt2 T A 14: 119,057,605 E536D probably benign Het
Usp54 T C 14: 20,562,240 E836G probably damaging Het
Vmn1r41 C T 6: 89,747,156 T63M unknown Het
Xrcc4 T C 13: 90,000,978 N141S probably damaging Het
Zfp638 T C 6: 83,867,173 V6A unknown Het
Other mutations in Vmn2r72
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00931:Vmn2r72 APN 7 85749646 missense probably benign 0.01
IGL01019:Vmn2r72 APN 7 85738334 missense probably benign 0.26
IGL01445:Vmn2r72 APN 7 85749646 missense probably benign 0.06
IGL02076:Vmn2r72 APN 7 85738367 missense probably damaging 1.00
IGL02082:Vmn2r72 APN 7 85738166 missense probably benign 0.00
IGL02086:Vmn2r72 APN 7 85738166 missense probably benign 0.00
IGL02089:Vmn2r72 APN 7 85738166 missense probably benign 0.00
IGL02125:Vmn2r72 APN 7 85750711 missense probably benign 0.00
IGL02146:Vmn2r72 APN 7 85737962 missense probably damaging 1.00
IGL02272:Vmn2r72 APN 7 85750693 missense probably benign
IGL02514:Vmn2r72 APN 7 85738699 missense possibly damaging 0.90
IGL02662:Vmn2r72 APN 7 85738183 missense probably benign 0.26
IGL02697:Vmn2r72 APN 7 85738671 missense probably benign 0.36
IGL02733:Vmn2r72 APN 7 85751813 missense probably benign 0.05
IGL03070:Vmn2r72 APN 7 85752041 splice site probably benign
IGL03150:Vmn2r72 APN 7 85751176 missense probably damaging 1.00
IGL03159:Vmn2r72 APN 7 85754954 missense probably benign 0.05
IGL03333:Vmn2r72 APN 7 85750867 missense probably benign 0.10
R0081:Vmn2r72 UTSW 7 85751836 missense probably benign 0.01
R0090:Vmn2r72 UTSW 7 85754876 missense probably benign
R0655:Vmn2r72 UTSW 7 85738111 nonsense probably null
R0778:Vmn2r72 UTSW 7 85749739 missense probably benign 0.00
R1169:Vmn2r72 UTSW 7 85751309 missense probably benign 0.01
R1172:Vmn2r72 UTSW 7 85751944 missense probably damaging 1.00
R1173:Vmn2r72 UTSW 7 85751944 missense probably damaging 1.00
R1175:Vmn2r72 UTSW 7 85751944 missense probably damaging 1.00
R1248:Vmn2r72 UTSW 7 85749188 missense probably benign 0.02
R1302:Vmn2r72 UTSW 7 85738257 missense probably damaging 1.00
R1506:Vmn2r72 UTSW 7 85749211 missense probably benign
R1632:Vmn2r72 UTSW 7 85751792 missense probably benign 0.13
R1775:Vmn2r72 UTSW 7 85738170 missense probably benign 0.01
R1962:Vmn2r72 UTSW 7 85749161 missense probably benign 0.00
R2201:Vmn2r72 UTSW 7 85738236 missense probably benign 0.12
R2290:Vmn2r72 UTSW 7 85738341 missense probably damaging 1.00
R2327:Vmn2r72 UTSW 7 85738256 missense probably damaging 1.00
R2424:Vmn2r72 UTSW 7 85750953 missense probably damaging 1.00
R2655:Vmn2r72 UTSW 7 85751269 missense possibly damaging 0.95
R2860:Vmn2r72 UTSW 7 85750836 missense probably damaging 0.99
R2861:Vmn2r72 UTSW 7 85750836 missense probably damaging 0.99
R2862:Vmn2r72 UTSW 7 85750836 missense probably damaging 0.99
R3009:Vmn2r72 UTSW 7 85749642 missense probably benign 0.00
R3797:Vmn2r72 UTSW 7 85738077 missense probably benign 0.44
R3798:Vmn2r72 UTSW 7 85738077 missense probably benign 0.44
R3902:Vmn2r72 UTSW 7 85749735 missense possibly damaging 0.52
R3959:Vmn2r72 UTSW 7 85751131 missense probably benign 0.36
R3974:Vmn2r72 UTSW 7 85749809 missense probably damaging 1.00
R4399:Vmn2r72 UTSW 7 85738500 missense probably damaging 1.00
R4421:Vmn2r72 UTSW 7 85738500 missense probably damaging 1.00
R4426:Vmn2r72 UTSW 7 85737828 nonsense probably null
R4522:Vmn2r72 UTSW 7 85751926 missense probably benign 0.44
R4523:Vmn2r72 UTSW 7 85751926 missense probably benign 0.44
R4533:Vmn2r72 UTSW 7 85751926 missense probably benign 0.44
R4691:Vmn2r72 UTSW 7 85737911 nonsense probably null
R4781:Vmn2r72 UTSW 7 85737861 missense probably benign 0.14
R4863:Vmn2r72 UTSW 7 85750598 missense possibly damaging 0.91
R4952:Vmn2r72 UTSW 7 85751109 missense probably benign
R4991:Vmn2r72 UTSW 7 85751130 missense probably damaging 0.99
R4995:Vmn2r72 UTSW 7 85738485 missense probably damaging 1.00
R5095:Vmn2r72 UTSW 7 85737853 missense probably damaging 0.98
R5174:Vmn2r72 UTSW 7 85737840 missense probably benign 0.00
R5276:Vmn2r72 UTSW 7 85738254 missense possibly damaging 0.90
R5395:Vmn2r72 UTSW 7 85750897 missense possibly damaging 0.71
R5560:Vmn2r72 UTSW 7 85751942 missense probably damaging 0.96
R5933:Vmn2r72 UTSW 7 85737850 missense probably benign 0.05
R6033:Vmn2r72 UTSW 7 85737929 missense probably damaging 1.00
R6033:Vmn2r72 UTSW 7 85737929 missense probably damaging 1.00
R6354:Vmn2r72 UTSW 7 85750539 critical splice donor site probably null
R6362:Vmn2r72 UTSW 7 85751174 missense probably damaging 1.00
R6594:Vmn2r72 UTSW 7 85749684 missense probably benign 0.32
R6794:Vmn2r72 UTSW 7 85737996 missense probably damaging 1.00
R7113:Vmn2r72 UTSW 7 85749803 splice site probably null
R7189:Vmn2r72 UTSW 7 85754917 missense probably benign 0.36
R7266:Vmn2r72 UTSW 7 85738274 nonsense probably null
R7323:Vmn2r72 UTSW 7 85750563 missense probably benign
R7426:Vmn2r72 UTSW 7 85751140 missense probably benign
R7606:Vmn2r72 UTSW 7 85751154 missense possibly damaging 0.91
R7651:Vmn2r72 UTSW 7 85751938 missense probably damaging 1.00
R7688:Vmn2r72 UTSW 7 85754890 missense probably benign 0.32
R7753:Vmn2r72 UTSW 7 85750626 missense probably damaging 1.00
R7843:Vmn2r72 UTSW 7 85749630 missense probably benign 0.01
R8157:Vmn2r72 UTSW 7 85751233 missense probably benign 0.09
R8254:Vmn2r72 UTSW 7 85751019 missense probably damaging 1.00
R8389:Vmn2r72 UTSW 7 85751960 missense probably damaging 0.99
R8444:Vmn2r72 UTSW 7 85738175 missense probably benign
R8989:Vmn2r72 UTSW 7 85754926 missense probably benign 0.10
R9015:Vmn2r72 UTSW 7 85749180 missense probably benign 0.01
Z1176:Vmn2r72 UTSW 7 85749191 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGAATGTATCAGGCAGGTTCC -3'
(R):5'- ATTGGTCATCCCACTACGGTC -3'

Sequencing Primer
(F):5'- GGTTCCTGGCCAAGAAAGCTAC -3'
(R):5'- GGTCATCTGTATCCTGCAGCAG -3'
Posted On2021-11-19