Mutagenetix > Incidental Mutation

Incidental Mutation 'R9080:Tnks'

689962

Institutional Source

Beutler Lab

Gene Symbol

Tnks

Ensembl Gene

ENSMUSG00000031529

Gene Name

tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase

Synonyms

mTNKS1, 4930554K12Rik, D130072O21Rik, TANK1, tankyrase 1

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9080 (G1)

Quality Score

105.467

Status

Not validated

Chromosome

Chromosomal Location

34826460-34965690 bp(-) (GRCm38)

Type of Mutation

small deletion (1 aa in frame mutation)

DNA Base Change (assembly)

CCCGCCGCCGCCGCCGCCGCCG to CCCGCCGCCGCCGCCGCCG at 34965312 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000033929 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033929]

AlphaFold

Q6PFX9

PDB Structure

Crystal structure of a mouse Tankyrase-Axin complex [X-RAY DIFFRACTION]
Co-crystal structure of tankyrase 1 with compound 3 [(4S)-3-{4-[6-amino-5-(pyrimidin-2-yl)pyridin-3-yl]phenyl}-5,5-dimethyl-4-phenyl-1,3-oxazolidin-2-one] [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000033929

SMART Domains

Protein: ENSMUSP00000033929
Gene: ENSMUSG00000031529

Domain	Start	End	E-Value	Type
low complexity region	8	17	N/A	INTRINSIC
low complexity region	20	55	N/A	INTRINSIC
low complexity region	68	86	N/A	INTRINSIC
low complexity region	91	175	N/A	INTRINSIC
ANK	208	237	4.26e-4	SMART
ANK	241	270	3.23e-4	SMART
ANK	274	303	3.28e-5	SMART
ANK	327	355	2.66e3	SMART
ANK	361	390	7.64e-6	SMART
ANK	394	423	2.62e-4	SMART
ANK	427	456	1.99e-4	SMART
ANK	514	546	3.18e-3	SMART
ANK	550	579	1.51e-4	SMART
ANK	583	612	4.26e-4	SMART
ANK	642	670	2.21e3	SMART
ANK	676	705	4.03e-5	SMART
ANK	709	738	2.48e-5	SMART
ANK	742	771	1.64e-5	SMART
low complexity region	792	810	N/A	INTRINSIC
ANK	829	858	1.47e-7	SMART
ANK	862	891	2.21e-2	SMART
ANK	895	924	3.13e-2	SMART
low complexity region	996	1010	N/A	INTRINSIC
SAM	1017	1082	1.14e-12	SMART
Pfam:PARP	1098	1303	1.5e-28	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele fail to exhibit any abonormalities. Male mice homozygous for a gene trapped allele exhibit decreased fat pad weight, increased metabolism, hyperinsulinemia, and hypoglycemia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5730596B20Rik	T	C	6: 52,178,993	I13T	unknown	Het
Adad1	G	T	3: 37,065,249	V160L	probably benign	Het
Adamts6	T	A	13: 104,312,919	M279K	probably damaging	Het
Adgra2	T	C	8: 27,114,501	S535P	probably benign	Het
Akr1c13	C	T	13: 4,191,173		probably benign	Het
Anapc1	A	G	2: 128,622,506	I1690T	possibly damaging	Het
Ccdc138	A	G	10: 58,562,062	M575V	probably damaging	Het
Cfap100	T	C	6: 90,406,201	N330S	unknown	Het
Col12a1	T	C	9: 79,609,851	D2849G	probably benign	Het
Cox11	G	A	11: 90,644,420	M232I	probably damaging	Het
Cpne7	C	T	8: 123,130,212	P402L	probably damaging	Het
Cspp1	G	A	1: 10,113,694	S848N	probably benign	Het
Cxcr5	A	G	9: 44,513,266	S365P	probably damaging	Het
Dclre1c	A	T	2: 3,457,552	M389L	probably benign	Het
Dlc1	T	C	8: 36,584,852	D124G	probably benign	Het
Dtx3	A	T	10: 127,191,268	S346T	possibly damaging	Het
E330021D16Rik	T	A	6: 136,400,722	D370V	probably damaging	Het
Exosc10	A	G	4: 148,564,664	D337G	probably damaging	Het
Fpr1	G	A	17: 17,876,950	A259V	probably benign	Het
Gm11232	A	T	4: 71,757,833	M25K	probably benign	Het
Gm4950	A	G	18: 51,865,850	V11A	possibly damaging	Het
Gsap	C	T	5: 21,194,412	T37I	possibly damaging	Het
Igfbp2	T	A	1: 72,851,998	C252S	probably damaging	Het
Ing2	T	C	8: 47,668,773	T247A	possibly damaging	Het
Ints1	C	T	5: 139,753,545	V2028M	probably benign	Het
Itfg1	A	G	8: 85,740,245	F400L	possibly damaging	Het
Itga6	A	G	2: 71,843,289	Y889C	probably benign	Het
Kcnh3	A	G	15: 99,241,786	E882G	probably damaging	Het
Limch1	T	A	5: 67,017,649	C515S	probably benign	Het
Lrrc74a	G	T	12: 86,749,134	V294F	possibly damaging	Het
Megf8	A	G	7: 25,341,706	E1120G	probably damaging	Het
Nbea	A	T	3: 56,005,095	Y1090*	probably null	Het
Nckap1	A	G	2: 80,520,382	Y794H	probably damaging	Het
Nfib	T	C	4: 82,705,517	M25V		Het
Ogfod2	A	G	5: 124,114,944	E339G	probably damaging	Het
Olah	T	A	2: 3,348,352	E64V	probably damaging	Het
Olfr237-ps1	T	A	6: 43,153,896	V197D	possibly damaging	Het
Olfr460	T	A	6: 40,571,629	L81H	probably damaging	Het
Pdcd6ip	T	A	9: 113,691,556	K120M	probably damaging	Het
Pex1	A	G	5: 3,605,476	I134V	probably damaging	Het
Plekhm2	T	C	4: 141,631,728	H576R	probably damaging	Het
Ptpn13	T	A	5: 103,489,628	H127Q	probably damaging	Het
Rmnd5b	C	T	11: 51,624,228		probably null	Het
Rsf1	A	AAGGCGACGG	7: 97,579,904		probably null	Het
Sec16b	C	A	1: 157,565,730	Q995K	probably benign	Het
Serpinb6d	T	A	13: 33,671,124	S260R	probably benign	Het
Slc47a1	C	T	11: 61,373,393	G67S	possibly damaging	Het
Slco6d1	T	C	1: 98,421,258	V18A	probably benign	Het
Tfcp2	GGTAATCCAAAGAGATGGACTGGTGGCTGTCCTGCTGCTGAGTAATCCAAAGAGATGGACTGGTGGCTGTCCTGCTGCTGAGTAATCCAAAGAGATGGACTGGTGGCTGTCCTGCTGCTGAGTAATCCAAAGAGATGGACTGGTGGCTGTCCTGCTGCTGA	GGTAATCCAAAGAGATGGACTGGTGGCTGTCCTGCTGCTGAGTAATCCAAAGAGATGGACTGGTGGCTGTCCTGCTGCTGAGTAATCCAAAGAGATGGACTGGTGGCTGTCCTGCTGCTGA	15: 100,498,087		probably null	Het
Tiam2	T	G	17: 3,414,244	C83G	probably benign	Het
Tln2	C	T	9: 67,346,561	G743R	probably damaging	Het
Tmem136	C	T	9: 43,111,369	R230Q	probably benign	Het
Ttn	G	A	2: 76,706,499	T34994I	probably benign	Het
Uggt2	T	A	14: 119,057,605	E536D	probably benign	Het
Usp54	T	C	14: 20,562,240	E836G	probably damaging	Het
Vmn1r41	C	T	6: 89,747,156	T63M	unknown	Het
Vmn2r72	A	C	7: 85,738,256	I700S	probably damaging	Het
Xrcc4	T	C	13: 90,000,978	N141S	probably damaging	Het
Zfp638	T	C	6: 83,867,173	V6A	unknown	Het

Other mutations in Tnks

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00498:Tnks	APN	8	34861689	splice site	probably benign
IGL00901:Tnks	APN	8	34838395	nonsense	probably null
IGL01448:Tnks	APN	8	34839982	missense	probably damaging	1.00
IGL01455:Tnks	APN	8	34940900	missense	probably damaging	0.99
IGL01962:Tnks	APN	8	34869524	missense	probably damaging	1.00
IGL02088:Tnks	APN	8	34839994	missense	possibly damaging	0.50
IGL02260:Tnks	APN	8	34842983	missense	probably damaging	0.99
IGL02454:Tnks	APN	8	34831728	unclassified	probably benign
IGL02486:Tnks	APN	8	34851198	missense	probably damaging	1.00
IGL02612:Tnks	APN	8	34849299	missense	possibly damaging	0.48
IGL03179:Tnks	APN	8	34848670	missense	probably benign	0.38
IGL03404:Tnks	APN	8	34940704	missense	probably damaging	1.00
R0256:Tnks	UTSW	8	34861547	missense	probably benign	0.07
R0265:Tnks	UTSW	8	34839970	nonsense	probably null
R0334:Tnks	UTSW	8	34853259	nonsense	probably null
R0414:Tnks	UTSW	8	34853309	missense	probably damaging	1.00
R0526:Tnks	UTSW	8	34853303	missense	probably benign	0.23
R0622:Tnks	UTSW	8	34940822	missense	probably damaging	1.00
R1445:Tnks	UTSW	8	34834603	splice site	probably benign
R1618:Tnks	UTSW	8	34875276	missense	probably damaging	1.00
R1779:Tnks	UTSW	8	34857518	missense	probably benign	0.18
R1919:Tnks	UTSW	8	34875232	missense	probably damaging	1.00
R1938:Tnks	UTSW	8	34838530	missense	probably damaging	1.00
R2018:Tnks	UTSW	8	34851106	missense	probably damaging	1.00
R2198:Tnks	UTSW	8	34848649	missense	probably benign
R2198:Tnks	UTSW	8	34873067	missense	probably benign	0.29
R2925:Tnks	UTSW	8	34965661	missense	unknown
R3828:Tnks	UTSW	8	34873178	missense	probably damaging	1.00
R3913:Tnks	UTSW	8	34873074	missense	probably damaging	0.99
R3916:Tnks	UTSW	8	34853361	missense	probably damaging	1.00
R3917:Tnks	UTSW	8	34853361	missense	probably damaging	1.00
R3930:Tnks	UTSW	8	34940812	missense	probably damaging	1.00
R4659:Tnks	UTSW	8	34849311	missense	possibly damaging	0.53
R4760:Tnks	UTSW	8	34851783	missense	probably benign	0.38
R5091:Tnks	UTSW	8	34841809	missense	probably benign	0.40
R5419:Tnks	UTSW	8	34965566	missense	unknown
R5558:Tnks	UTSW	8	34965665	start codon destroyed	probably null
R5582:Tnks	UTSW	8	34940861	missense	probably benign	0.14
R6035:Tnks	UTSW	8	34918461	missense	possibly damaging	0.93
R6035:Tnks	UTSW	8	34918461	missense	possibly damaging	0.93
R6495:Tnks	UTSW	8	34839966	critical splice donor site	probably null
R6527:Tnks	UTSW	8	34873093	missense	probably benign	0.36
R6991:Tnks	UTSW	8	34834493	missense	probably damaging	1.00
R7015:Tnks	UTSW	8	34838547	missense	probably benign	0.04
R7038:Tnks	UTSW	8	34851636	missense	probably damaging	0.99
R7057:Tnks	UTSW	8	34840014	missense	probably damaging	1.00
R7167:Tnks	UTSW	8	34849304	missense	probably damaging	0.98
R7250:Tnks	UTSW	8	34851758	missense	probably damaging	0.98
R7475:Tnks	UTSW	8	34831712	missense	probably damaging	1.00
R7790:Tnks	UTSW	8	34861540	missense	probably benign	0.01
R7818:Tnks	UTSW	8	34873028	missense	probably benign	0.03
R7909:Tnks	UTSW	8	34940704	missense	probably damaging	1.00
R7970:Tnks	UTSW	8	34855926	critical splice donor site	probably null
R8341:Tnks	UTSW	8	34873045	missense	probably damaging	1.00
R8343:Tnks	UTSW	8	34834584	missense	probably benign	0.03
R8870:Tnks	UTSW	8	34847279	critical splice donor site	probably null
R8936:Tnks	UTSW	8	34853347	nonsense	probably null
R9049:Tnks	UTSW	8	34841778	missense	probably damaging	0.96
R9182:Tnks	UTSW	8	34841751	critical splice donor site	probably null
R9211:Tnks	UTSW	8	34849335	missense	probably damaging	1.00
R9425:Tnks	UTSW	8	34873665	missense	probably damaging	1.00
R9649:Tnks	UTSW	8	34838935	missense	probably damaging	0.96
Z1177:Tnks	UTSW	8	34965145	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- ATGTCCTTGGCATTCACGTTCG -3'
(R):5'- GTCCAGAATCCGGAAGTGAG -3'

Sequencing Primer
(F):5'- ATTCCGACAGGCCTCGAG -3'
(R):5'- TTGCCGCAGTGACAGTAC -3'

Posted On

2021-11-19