Incidental Mutation 'R9081:Rif1'
ID 689996
Institutional Source Beutler Lab
Gene Symbol Rif1
Ensembl Gene ENSMUSG00000036202
Gene Name replication timing regulatory factor 1
Synonyms 6530403D07Rik, 5730435J01Rik, D2Ertd145e
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9081 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 52072832-52122383 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 52110977 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 1481 (T1481I)
Ref Sequence ENSEMBL: ENSMUSP00000108313 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112693]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000112693
AA Change: T1481I

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000108313
Gene: ENSMUSG00000036202
AA Change: T1481I

DomainStartEndE-ValueType
Pfam:Rif1_N 18 381 1.4e-85 PFAM
low complexity region 432 444 N/A INTRINSIC
low complexity region 586 598 N/A INTRINSIC
low complexity region 1018 1038 N/A INTRINSIC
low complexity region 1180 1205 N/A INTRINSIC
low complexity region 1310 1321 N/A INTRINSIC
low complexity region 1423 1446 N/A INTRINSIC
low complexity region 1576 1586 N/A INTRINSIC
low complexity region 1677 1690 N/A INTRINSIC
low complexity region 1702 1712 N/A INTRINSIC
low complexity region 2176 2195 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125322
Predicted Effect probably benign
Transcript: ENSMUST00000125376
Predicted Effect probably benign
Transcript: ENSMUST00000152178
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that shares homology with the yeast teleomere binding protein, Rap1 interacting factor 1. This protein localizes to aberrant telomeres may be involved in DNA repair. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality. Mice homozygous for a gene trap allele exhibit embryonic and postnatal lethality, reduced fertility, and decreased cell proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aaas A T 15: 102,340,067 V271E probably damaging Het
Abca1 A G 4: 53,109,162 probably null Het
Abcb11 C T 2: 69,292,044 C365Y possibly damaging Het
Abcd2 A T 15: 91,191,569 W14R probably damaging Het
Acmsd A G 1: 127,759,731 D250G possibly damaging Het
Ahnak T A 19: 9,008,526 D2391E possibly damaging Het
Apol11b C T 15: 77,640,571 E5K possibly damaging Het
Cbr1 G T 16: 93,610,106 G237* probably null Het
Cdr2l T A 11: 115,394,113 V425E probably damaging Het
Chd9 A T 8: 90,977,516 K693* probably null Het
Clgn T G 8: 83,426,540 D590E probably damaging Het
Col14a1 T A 15: 55,427,991 S952T unknown Het
Crip3 T C 17: 46,430,033 L90P probably benign Het
Dchs1 A G 7: 105,754,429 S2969P probably benign Het
Dnaic2 T A 11: 114,738,667 D173E probably damaging Het
Dnpep A T 1: 75,314,416 F257Y probably damaging Het
Egln2 A G 7: 27,164,861 V213A probably benign Het
Epha8 G T 4: 136,938,586 L420M probably damaging Het
Eps8 A G 6: 137,527,417 I106T probably benign Het
Evi5 A G 5: 107,815,705 F379L probably benign Het
Fbxo31 G A 8: 121,554,397 R337C probably damaging Het
Fpgs A T 2: 32,687,488 probably benign Het
Garnl3 T G 2: 33,006,908 D573A possibly damaging Het
Gja8 A G 3: 96,919,360 S329P probably damaging Het
Gzf1 T A 2: 148,683,397 probably benign Het
Hgs T A 11: 120,475,250 probably benign Het
Ifi203 A G 1: 173,929,482 I245T unknown Het
Ighv1-74 C A 12: 115,802,834 W55C probably damaging Het
Iqcb1 A G 16: 36,835,644 K131R probably null Het
Kdelc1 T A 1: 44,114,806 Q161L probably benign Het
Kit A T 5: 75,640,558 M539L probably benign Het
Klk1 A G 7: 44,225,528 probably benign Het
Krt84 C T 15: 101,532,379 G126D unknown Het
Lama5 A T 2: 180,192,137 C1473* probably null Het
Loxl3 T C 6: 83,048,657 V332A possibly damaging Het
Mcf2l T A 8: 13,018,697 Y1120N probably damaging Het
Meioc G A 11: 102,674,175 V150M probably benign Het
Mybpc1 T G 10: 88,553,306 Y400S probably damaging Het
Ncmap T C 4: 135,376,981 probably benign Het
Noc2l A G 4: 156,241,767 Y437C probably damaging Het
Nol8 A T 13: 49,661,405 M330L probably benign Het
Olfr1467 C T 19: 13,364,655 T9I probably benign Het
Olfr961 A T 9: 39,646,900 Y58F probably damaging Het
P4ha1 T C 10: 59,348,363 Y216H probably damaging Het
Pamr1 A T 2: 102,611,588 D174V probably damaging Het
Pdcd1 C T 1: 94,041,155 probably null Het
Plec A G 15: 76,175,708 V3343A probably damaging Het
Pnliprp1 A T 19: 58,734,974 I266F probably benign Het
Ppp1r12b C T 1: 134,777,347 V868I probably benign Het
Ppp2r2b A T 18: 42,648,760 H325Q probably benign Het
Rnf213 A T 11: 119,466,236 D4204V Het
Rps6kl1 T C 12: 85,139,107 N409S probably damaging Het
Rundc1 T G 11: 101,425,227 W42G probably damaging Het
Sec1 C T 7: 45,684,563 probably benign Het
Sez6 G A 11: 77,974,295 E623K possibly damaging Het
Shc2 T C 10: 79,626,928 probably null Het
Slc19a1 T C 10: 77,041,916 V95A possibly damaging Het
Slc22a5 A T 11: 53,871,621 D333E probably damaging Het
Specc1 A C 11: 62,119,225 R522S possibly damaging Het
Syne2 C T 12: 75,969,516 Q3291* probably null Het
Taar7e G A 10: 24,037,995 V128I probably benign Het
Tdrd3 A G 14: 87,506,281 N555S probably benign Het
Themis C T 10: 28,668,586 probably benign Het
Tjp1 A G 7: 65,314,262 V945A possibly damaging Het
Tom1 G A 8: 75,051,523 V78I probably damaging Het
Usp13 A G 3: 32,881,393 T323A probably benign Het
Usp49 T C 17: 47,673,311 S414P possibly damaging Het
Vmn1r104 G A 7: 20,534,453 S206N probably damaging Het
Vps45 A T 3: 96,032,813 V446E probably benign Het
Wwc1 T C 11: 35,891,504 K222R probably benign Het
Zc3h13 CAGAGACCGGGACAGAAGGAGAGAC CAGAGAC 14: 75,331,941 probably benign Het
Other mutations in Rif1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Rif1 APN 2 52121007 missense probably damaging 0.96
IGL00711:Rif1 APN 2 52111070 missense probably benign 0.00
IGL00721:Rif1 APN 2 52119117 missense probably damaging 1.00
IGL01085:Rif1 APN 2 52085140 missense possibly damaging 0.71
IGL01093:Rif1 APN 2 52095948 missense probably damaging 1.00
IGL01107:Rif1 APN 2 52111303 missense probably benign 0.00
IGL01138:Rif1 APN 2 52111522 missense probably damaging 1.00
IGL01844:Rif1 APN 2 52112543 missense probably benign 0.07
IGL02441:Rif1 APN 2 52105515 missense probably benign 0.00
IGL02448:Rif1 APN 2 52116696 missense probably damaging 0.99
IGL02563:Rif1 APN 2 52077065 missense probably damaging 1.00
IGL02704:Rif1 APN 2 52093576 missense probably damaging 1.00
IGL02946:Rif1 APN 2 52110125 nonsense probably null
IGL03060:Rif1 APN 2 52112137 missense probably damaging 0.97
IGL03206:Rif1 APN 2 52103622 missense probably damaging 1.00
IGL03263:Rif1 APN 2 52090261 missense probably damaging 0.99
IGL03267:Rif1 APN 2 52076988 missense possibly damaging 0.94
IGL03280:Rif1 APN 2 52112599 missense probably benign 0.32
hifi UTSW 2 52110324 unclassified probably benign
nietzsche UTSW 2 52077020 missense probably benign 0.08
PIT4305001:Rif1 UTSW 2 52111958 missense
R0017:Rif1 UTSW 2 52116674 missense probably benign 0.18
R0017:Rif1 UTSW 2 52116674 missense probably benign 0.18
R0060:Rif1 UTSW 2 52111117 missense probably damaging 1.00
R0060:Rif1 UTSW 2 52111117 missense probably damaging 1.00
R0104:Rif1 UTSW 2 52110092 missense possibly damaging 0.77
R0268:Rif1 UTSW 2 52090286 critical splice donor site probably null
R0276:Rif1 UTSW 2 52110324 unclassified probably benign
R0278:Rif1 UTSW 2 52110324 unclassified probably benign
R0288:Rif1 UTSW 2 52110013 missense probably damaging 1.00
R0314:Rif1 UTSW 2 52110324 unclassified probably benign
R0345:Rif1 UTSW 2 52110324 unclassified probably benign
R0346:Rif1 UTSW 2 52110324 unclassified probably benign
R0383:Rif1 UTSW 2 52085141 missense probably damaging 0.96
R0384:Rif1 UTSW 2 52110324 unclassified probably benign
R0387:Rif1 UTSW 2 52110324 unclassified probably benign
R0388:Rif1 UTSW 2 52110324 unclassified probably benign
R0456:Rif1 UTSW 2 52110324 unclassified probably benign
R0477:Rif1 UTSW 2 52110324 unclassified probably benign
R0505:Rif1 UTSW 2 52110737 missense probably damaging 0.99
R0510:Rif1 UTSW 2 52110324 unclassified probably benign
R0511:Rif1 UTSW 2 52110324 unclassified probably benign
R0512:Rif1 UTSW 2 52110324 unclassified probably benign
R0633:Rif1 UTSW 2 52112563 missense probably benign 0.00
R0637:Rif1 UTSW 2 52110324 unclassified probably benign
R0638:Rif1 UTSW 2 52111588 missense probably benign 0.12
R0666:Rif1 UTSW 2 52110324 unclassified probably benign
R0675:Rif1 UTSW 2 52110324 unclassified probably benign
R0707:Rif1 UTSW 2 52110324 unclassified probably benign
R0726:Rif1 UTSW 2 52110353 missense possibly damaging 0.52
R0743:Rif1 UTSW 2 52110324 unclassified probably benign
R0744:Rif1 UTSW 2 52110324 unclassified probably benign
R0938:Rif1 UTSW 2 52110324 unclassified probably benign
R0939:Rif1 UTSW 2 52110324 unclassified probably benign
R0940:Rif1 UTSW 2 52110324 unclassified probably benign
R0941:Rif1 UTSW 2 52110324 unclassified probably benign
R0942:Rif1 UTSW 2 52110324 unclassified probably benign
R0943:Rif1 UTSW 2 52110324 unclassified probably benign
R1006:Rif1 UTSW 2 52085029 missense probably damaging 0.99
R1052:Rif1 UTSW 2 52111562 missense probably benign 0.01
R1061:Rif1 UTSW 2 52110324 unclassified probably benign
R1175:Rif1 UTSW 2 52107628 unclassified probably benign
R1183:Rif1 UTSW 2 52110324 unclassified probably benign
R1184:Rif1 UTSW 2 52110324 unclassified probably benign
R1271:Rif1 UTSW 2 52110324 unclassified probably benign
R1332:Rif1 UTSW 2 52078314 missense probably benign 0.06
R1336:Rif1 UTSW 2 52078314 missense probably benign 0.06
R1351:Rif1 UTSW 2 52111555 missense possibly damaging 0.74
R1517:Rif1 UTSW 2 52110324 unclassified probably benign
R1527:Rif1 UTSW 2 52110324 unclassified probably benign
R1560:Rif1 UTSW 2 52111131 missense probably damaging 1.00
R1563:Rif1 UTSW 2 52073223 missense probably damaging 0.99
R1571:Rif1 UTSW 2 52110324 unclassified probably benign
R1625:Rif1 UTSW 2 52103640 missense probably benign 0.25
R1679:Rif1 UTSW 2 52110324 unclassified probably benign
R1689:Rif1 UTSW 2 52110324 unclassified probably benign
R1731:Rif1 UTSW 2 52110324 unclassified probably benign
R1744:Rif1 UTSW 2 52112392 missense possibly damaging 0.56
R1746:Rif1 UTSW 2 52110324 unclassified probably benign
R1748:Rif1 UTSW 2 52110324 unclassified probably benign
R1831:Rif1 UTSW 2 52078495 nonsense probably null
R1902:Rif1 UTSW 2 52116673 missense possibly damaging 0.93
R1964:Rif1 UTSW 2 52098409 missense probably benign 0.01
R1978:Rif1 UTSW 2 52110324 unclassified probably benign
R2000:Rif1 UTSW 2 52081298 missense probably damaging 0.99
R2030:Rif1 UTSW 2 52092346 missense probably damaging 1.00
R2056:Rif1 UTSW 2 52093576 missense probably damaging 1.00
R2106:Rif1 UTSW 2 52110324 unclassified probably benign
R2109:Rif1 UTSW 2 52110324 unclassified probably benign
R2125:Rif1 UTSW 2 52110324 unclassified probably benign
R2126:Rif1 UTSW 2 52110324 unclassified probably benign
R2145:Rif1 UTSW 2 52111400 missense possibly damaging 0.63
R2152:Rif1 UTSW 2 52110324 unclassified probably benign
R2153:Rif1 UTSW 2 52110324 unclassified probably benign
R2213:Rif1 UTSW 2 52110324 unclassified probably benign
R2327:Rif1 UTSW 2 52110324 unclassified probably benign
R2512:Rif1 UTSW 2 52110324 unclassified probably benign
R2513:Rif1 UTSW 2 52110324 unclassified probably benign
R2516:Rif1 UTSW 2 52110324 unclassified probably benign
R2520:Rif1 UTSW 2 52110324 unclassified probably benign
R2905:Rif1 UTSW 2 52098504 missense probably damaging 0.99
R3005:Rif1 UTSW 2 52082764 missense probably damaging 1.00
R3155:Rif1 UTSW 2 52110324 unclassified probably benign
R3156:Rif1 UTSW 2 52110324 unclassified probably benign
R3429:Rif1 UTSW 2 52110324 unclassified probably benign
R3707:Rif1 UTSW 2 52093580 missense probably damaging 1.00
R3907:Rif1 UTSW 2 52112545 missense probably benign 0.03
R3978:Rif1 UTSW 2 52116747 critical splice donor site probably null
R4023:Rif1 UTSW 2 52121087 missense probably benign 0.01
R4052:Rif1 UTSW 2 52098471 nonsense probably null
R4668:Rif1 UTSW 2 52111952 missense probably benign 0.01
R4674:Rif1 UTSW 2 52106942 missense probably null 1.00
R4715:Rif1 UTSW 2 52073139 utr 5 prime probably benign
R4766:Rif1 UTSW 2 52098934 missense probably damaging 1.00
R4783:Rif1 UTSW 2 52112747 missense probably damaging 0.96
R4785:Rif1 UTSW 2 52112747 missense probably damaging 0.96
R4869:Rif1 UTSW 2 52093611 intron probably benign
R4911:Rif1 UTSW 2 52110518 missense probably damaging 0.98
R4951:Rif1 UTSW 2 52084986 splice site probably null
R5044:Rif1 UTSW 2 52109928 missense probably damaging 0.99
R5088:Rif1 UTSW 2 52092295 missense possibly damaging 0.91
R5151:Rif1 UTSW 2 52120309 missense probably damaging 1.00
R5187:Rif1 UTSW 2 52081289 missense probably damaging 1.00
R5222:Rif1 UTSW 2 52077020 missense probably benign 0.08
R5243:Rif1 UTSW 2 52111824 missense possibly damaging 0.86
R5436:Rif1 UTSW 2 52120971 intron probably benign
R5476:Rif1 UTSW 2 52089595 missense probably damaging 1.00
R5496:Rif1 UTSW 2 52098916 missense probably damaging 1.00
R5641:Rif1 UTSW 2 52121158 missense possibly damaging 0.80
R5883:Rif1 UTSW 2 52105639 critical splice donor site probably null
R5987:Rif1 UTSW 2 52095844 missense probably damaging 1.00
R5990:Rif1 UTSW 2 52095844 missense probably damaging 1.00
R5992:Rif1 UTSW 2 52095844 missense probably damaging 1.00
R6019:Rif1 UTSW 2 52095844 missense probably damaging 1.00
R6020:Rif1 UTSW 2 52095844 missense probably damaging 1.00
R6255:Rif1 UTSW 2 52085053 missense probably damaging 1.00
R6342:Rif1 UTSW 2 52119156 missense probably damaging 0.97
R6364:Rif1 UTSW 2 52107669 missense probably damaging 0.97
R6747:Rif1 UTSW 2 52078263 splice site probably null
R6928:Rif1 UTSW 2 52095961 missense probably damaging 1.00
R6954:Rif1 UTSW 2 52112691 missense probably benign 0.00
R7003:Rif1 UTSW 2 52076989 missense probably benign 0.06
R7310:Rif1 UTSW 2 52105619 missense probably benign 0.12
R7549:Rif1 UTSW 2 52078507 missense possibly damaging 0.52
R7603:Rif1 UTSW 2 52076175 missense probably damaging 1.00
R7673:Rif1 UTSW 2 52088654 missense probably damaging 1.00
R7741:Rif1 UTSW 2 52085141 missense probably damaging 0.96
R7777:Rif1 UTSW 2 52116356 missense probably benign 0.00
R7910:Rif1 UTSW 2 52078387 nonsense probably null
R7962:Rif1 UTSW 2 52074276 missense probably damaging 1.00
R8264:Rif1 UTSW 2 52090278 missense noncoding transcript
R8390:Rif1 UTSW 2 52110923 missense probably damaging 1.00
R8479:Rif1 UTSW 2 52112551 missense possibly damaging 0.52
R8490:Rif1 UTSW 2 52110999 missense probably damaging 0.96
R8762:Rif1 UTSW 2 52111730 missense
R8785:Rif1 UTSW 2 52110481 missense probably benign 0.06
R8890:Rif1 UTSW 2 52098863 missense probably damaging 0.99
R9225:Rif1 UTSW 2 52111850 missense probably benign 0.22
R9284:Rif1 UTSW 2 52108552 missense probably benign 0.00
R9300:Rif1 UTSW 2 52111139 missense probably damaging 1.00
R9366:Rif1 UTSW 2 52120344 missense
R9477:Rif1 UTSW 2 52111330 missense probably benign 0.02
R9522:Rif1 UTSW 2 52081299 missense probably damaging 1.00
R9573:Rif1 UTSW 2 52110454 missense probably benign 0.29
R9630:Rif1 UTSW 2 52089595 missense probably damaging 1.00
X0064:Rif1 UTSW 2 52074315 missense probably benign 0.00
X0064:Rif1 UTSW 2 52094633 missense probably damaging 0.96
Z1177:Rif1 UTSW 2 52088648 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTGCAGTGACAGCCAAGAG -3'
(R):5'- GCCTCAGAACTGTCAGATTCTG -3'

Sequencing Primer
(F):5'- CCAAGAGAGAGAGAGTGGTCAGC -3'
(R):5'- CTGTCAGATTCTGAGTTTTCAACAGC -3'
Posted On 2021-11-19