Incidental Mutation 'R9081:Dchs1'
ID 690013
Institutional Source Beutler Lab
Gene Symbol Dchs1
Ensembl Gene ENSMUSG00000036862
Gene Name dachsous cadherin related 1
Synonyms C130033F22Rik, 3110041P15Rik
MMRRC Submission 068900-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9081 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 105402197-105436861 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 105403636 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 2969 (S2969P)
Ref Sequence ENSEMBL: ENSMUSP00000077574 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033184] [ENSMUST00000078482] [ENSMUST00000210066]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000033184
SMART Domains Protein: ENSMUSP00000033184
Gene: ENSMUSG00000030894

low complexity region 2 17 N/A INTRINSIC
Pro-kuma_activ 32 176 4.53e-50 SMART
low complexity region 177 189 N/A INTRINSIC
Pfam:Peptidase_S8 251 492 1.1e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000078482
AA Change: S2969P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000077574
Gene: ENSMUSG00000036862
AA Change: S2969P

signal peptide 1 36 N/A INTRINSIC
CA 58 135 5.2e-11 SMART
CA 159 247 6.1e-17 SMART
CA 271 354 2.6e-30 SMART
CA 382 464 7.8e-26 SMART
CA 489 570 1.2e-34 SMART
CA 594 677 1.9e-27 SMART
CA 701 782 5.3e-11 SMART
CA 806 886 1e-12 SMART
CA 910 990 3.3e-14 SMART
CA 1016 1097 3.6e-18 SMART
CA 1121 1203 3.1e-34 SMART
CA 1233 1307 8.8e-16 SMART
low complexity region 1323 1335 N/A INTRINSIC
CA 1344 1427 9.9e-9 SMART
CA 1451 1537 1.5e-23 SMART
CA 1560 1640 7.2e-32 SMART
CA 1664 1742 1.8e-31 SMART
CA 1765 1846 7.8e-30 SMART
CA 1870 1951 3.7e-26 SMART
low complexity region 1957 1965 N/A INTRINSIC
CA 1979 2059 1.1e-6 SMART
CA 2083 2162 2.7e-18 SMART
CA 2186 2268 2.2e-26 SMART
CA 2291 2367 1e-18 SMART
CA 2391 2473 1.8e-23 SMART
CA 2497 2593 3.5e-21 SMART
CA 2617 2697 1.2e-25 SMART
CA 2721 2804 1.9e-18 SMART
CA 2828 2919 3e-3 SMART
transmembrane domain 2932 2954 N/A INTRINSIC
low complexity region 3001 3017 N/A INTRINSIC
low complexity region 3046 3055 N/A INTRINSIC
low complexity region 3088 3097 N/A INTRINSIC
low complexity region 3185 3196 N/A INTRINSIC
low complexity region 3237 3259 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140959
Predicted Effect probably benign
Transcript: ENSMUST00000210066
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the cadherin superfamily whose members encode calcium-dependent cell-cell adhesion molecules. The encoded protein has a signal peptide, 27 cadherin repeat domains and a unique cytoplasmic region. This particular cadherin family member is expressed in fibroblasts but not in melanocytes or keratinocytes. The cell-cell adhesion of fibroblasts is thought to be necessary for wound healing. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit postnatal lethality, growth retardation, small lungs, abnormal cochlea morphology, abnormal kidney morphology, cardiovascular abnormalities and skeletal abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aaas A T 15: 102,248,502 (GRCm39) V271E probably damaging Het
Abca1 A G 4: 53,109,162 (GRCm39) probably null Het
Abcb11 C T 2: 69,122,388 (GRCm39) C365Y possibly damaging Het
Abcd2 A T 15: 91,075,772 (GRCm39) W14R probably damaging Het
Acmsd A G 1: 127,687,468 (GRCm39) D250G possibly damaging Het
Ahnak T A 19: 8,985,890 (GRCm39) D2391E possibly damaging Het
Apol11b C T 15: 77,524,771 (GRCm39) E5K possibly damaging Het
Cbr1 G T 16: 93,406,994 (GRCm39) G237* probably null Het
Cdr2l T A 11: 115,284,939 (GRCm39) V425E probably damaging Het
Chd9 A T 8: 91,704,144 (GRCm39) K693* probably null Het
Clgn T G 8: 84,153,169 (GRCm39) D590E probably damaging Het
Col14a1 T A 15: 55,291,387 (GRCm39) S952T unknown Het
Crip3 T C 17: 46,740,959 (GRCm39) L90P probably benign Het
Dnai2 T A 11: 114,629,493 (GRCm39) D173E probably damaging Het
Dnpep A T 1: 75,291,060 (GRCm39) F257Y probably damaging Het
Egln2 A G 7: 26,864,286 (GRCm39) V213A probably benign Het
Epha8 G T 4: 136,665,897 (GRCm39) L420M probably damaging Het
Eps8 A G 6: 137,504,415 (GRCm39) I106T probably benign Het
Evi5 A G 5: 107,963,571 (GRCm39) F379L probably benign Het
Fbxo31 G A 8: 122,281,136 (GRCm39) R337C probably damaging Het
Fpgs A T 2: 32,577,500 (GRCm39) probably benign Het
Garnl3 T G 2: 32,896,920 (GRCm39) D573A possibly damaging Het
Gja8 A G 3: 96,826,676 (GRCm39) S329P probably damaging Het
Gzf1 T A 2: 148,525,317 (GRCm39) probably benign Het
Hgs T A 11: 120,366,076 (GRCm39) probably benign Het
Ifi203 A G 1: 173,757,048 (GRCm39) I245T unknown Het
Ighv1-74 C A 12: 115,766,454 (GRCm39) W55C probably damaging Het
Iqcb1 A G 16: 36,656,006 (GRCm39) K131R probably null Het
Kit A T 5: 75,801,218 (GRCm39) M539L probably benign Het
Klk1 A G 7: 43,874,952 (GRCm39) probably benign Het
Krt84 C T 15: 101,440,814 (GRCm39) G126D unknown Het
Lama5 A T 2: 179,833,930 (GRCm39) C1473* probably null Het
Loxl3 T C 6: 83,025,638 (GRCm39) V332A possibly damaging Het
Mcf2l T A 8: 13,068,697 (GRCm39) Y1120N probably damaging Het
Meioc G A 11: 102,565,001 (GRCm39) V150M probably benign Het
Mybpc1 T G 10: 88,389,168 (GRCm39) Y400S probably damaging Het
Ncmap T C 4: 135,104,292 (GRCm39) probably benign Het
Noc2l A G 4: 156,326,224 (GRCm39) Y437C probably damaging Het
Nol8 A T 13: 49,814,881 (GRCm39) M330L probably benign Het
Or10d4c A T 9: 39,558,196 (GRCm39) Y58F probably damaging Het
Or5b113 C T 19: 13,342,019 (GRCm39) T9I probably benign Het
P4ha1 T C 10: 59,184,185 (GRCm39) Y216H probably damaging Het
Pamr1 A T 2: 102,441,933 (GRCm39) D174V probably damaging Het
Pdcd1 C T 1: 93,968,880 (GRCm39) probably null Het
Plec A G 15: 76,059,908 (GRCm39) V3343A probably damaging Het
Pnliprp1 A T 19: 58,723,406 (GRCm39) I266F probably benign Het
Poglut2 T A 1: 44,153,966 (GRCm39) Q161L probably benign Het
Ppp1r12b C T 1: 134,705,085 (GRCm39) V868I probably benign Het
Ppp2r2b A T 18: 42,781,825 (GRCm39) H325Q probably benign Het
Rif1 C T 2: 52,000,989 (GRCm39) T1481I probably damaging Het
Rnf213 A T 11: 119,357,062 (GRCm39) D4204V Het
Rps6kl1 T C 12: 85,185,881 (GRCm39) N409S probably damaging Het
Rundc1 T G 11: 101,316,053 (GRCm39) W42G probably damaging Het
Sec1 C T 7: 45,333,987 (GRCm39) probably benign Het
Sez6 G A 11: 77,865,121 (GRCm39) E623K possibly damaging Het
Shc2 T C 10: 79,462,762 (GRCm39) probably null Het
Slc19a1 T C 10: 76,877,750 (GRCm39) V95A possibly damaging Het
Slc22a5 A T 11: 53,762,447 (GRCm39) D333E probably damaging Het
Specc1 A C 11: 62,010,051 (GRCm39) R522S possibly damaging Het
Syne2 C T 12: 76,016,290 (GRCm39) Q3291* probably null Het
Taar7e G A 10: 23,913,893 (GRCm39) V128I probably benign Het
Tdrd3 A G 14: 87,743,717 (GRCm39) N555S probably benign Het
Themis C T 10: 28,544,582 (GRCm39) probably benign Het
Tjp1 A G 7: 64,964,010 (GRCm39) V945A possibly damaging Het
Tom1 G A 8: 75,778,151 (GRCm39) V78I probably damaging Het
Usp13 A G 3: 32,935,542 (GRCm39) T323A probably benign Het
Usp49 T C 17: 47,984,236 (GRCm39) S414P possibly damaging Het
Vmn1r104 G A 7: 20,268,378 (GRCm39) S206N probably damaging Het
Vps45 A T 3: 95,940,125 (GRCm39) V446E probably benign Het
Wwc1 T C 11: 35,782,331 (GRCm39) K222R probably benign Het
Zc3h13 CAGAGACCGGGACAGAAGGAGAGAC CAGAGAC 14: 75,569,381 (GRCm39) probably benign Het
Other mutations in Dchs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Dchs1 APN 7 105,407,950 (GRCm39) missense probably damaging 1.00
IGL00422:Dchs1 APN 7 105,407,236 (GRCm39) missense possibly damaging 0.88
IGL00427:Dchs1 APN 7 105,407,631 (GRCm39) missense probably damaging 0.98
IGL00469:Dchs1 APN 7 105,404,468 (GRCm39) missense probably damaging 1.00
IGL00470:Dchs1 APN 7 105,407,414 (GRCm39) missense probably damaging 1.00
IGL00534:Dchs1 APN 7 105,407,150 (GRCm39) missense probably benign
IGL01292:Dchs1 APN 7 105,410,098 (GRCm39) missense probably damaging 0.98
IGL01380:Dchs1 APN 7 105,411,418 (GRCm39) missense probably damaging 1.00
IGL01396:Dchs1 APN 7 105,421,490 (GRCm39) missense probably damaging 1.00
IGL01448:Dchs1 APN 7 105,421,134 (GRCm39) missense probably damaging 0.98
IGL01759:Dchs1 APN 7 105,404,509 (GRCm39) missense probably benign 0.00
IGL01829:Dchs1 APN 7 105,404,604 (GRCm39) missense probably damaging 0.99
IGL01946:Dchs1 APN 7 105,408,312 (GRCm39) missense probably damaging 1.00
IGL01955:Dchs1 APN 7 105,406,798 (GRCm39) missense probably benign 0.00
IGL02012:Dchs1 APN 7 105,413,504 (GRCm39) missense probably damaging 0.98
IGL02222:Dchs1 APN 7 105,414,094 (GRCm39) missense probably damaging 1.00
IGL02261:Dchs1 APN 7 105,421,776 (GRCm39) missense probably damaging 1.00
IGL02365:Dchs1 APN 7 105,404,395 (GRCm39) missense probably benign 0.22
IGL02430:Dchs1 APN 7 105,421,178 (GRCm39) missense probably benign 0.34
IGL02500:Dchs1 APN 7 105,405,013 (GRCm39) missense probably benign
IGL02741:Dchs1 APN 7 105,406,530 (GRCm39) missense probably damaging 1.00
IGL02890:Dchs1 APN 7 105,405,698 (GRCm39) missense probably damaging 1.00
IGL03213:Dchs1 APN 7 105,404,279 (GRCm39) missense probably damaging 1.00
G1patch:Dchs1 UTSW 7 105,408,000 (GRCm39) missense probably damaging 0.99
P0026:Dchs1 UTSW 7 105,407,612 (GRCm39) missense probably damaging 0.99
PIT4377001:Dchs1 UTSW 7 105,406,795 (GRCm39) missense probably damaging 1.00
PIT4791001:Dchs1 UTSW 7 105,408,178 (GRCm39) missense probably damaging 1.00
R0013:Dchs1 UTSW 7 105,405,043 (GRCm39) missense possibly damaging 0.90
R0090:Dchs1 UTSW 7 105,405,139 (GRCm39) missense probably benign 0.18
R0091:Dchs1 UTSW 7 105,415,301 (GRCm39) splice site probably benign
R0193:Dchs1 UTSW 7 105,414,190 (GRCm39) missense probably benign 0.40
R0395:Dchs1 UTSW 7 105,407,745 (GRCm39) missense probably damaging 1.00
R0448:Dchs1 UTSW 7 105,415,134 (GRCm39) missense probably benign 0.00
R0480:Dchs1 UTSW 7 105,420,696 (GRCm39) missense probably benign 0.14
R0485:Dchs1 UTSW 7 105,421,934 (GRCm39) missense probably benign 0.00
R0566:Dchs1 UTSW 7 105,408,402 (GRCm39) missense probably benign 0.00
R0571:Dchs1 UTSW 7 105,421,203 (GRCm39) missense probably damaging 1.00
R0573:Dchs1 UTSW 7 105,407,985 (GRCm39) missense probably damaging 0.98
R0577:Dchs1 UTSW 7 105,413,462 (GRCm39) missense possibly damaging 0.78
R0622:Dchs1 UTSW 7 105,412,656 (GRCm39) missense probably damaging 1.00
R0654:Dchs1 UTSW 7 105,421,556 (GRCm39) missense probably damaging 1.00
R0677:Dchs1 UTSW 7 105,414,191 (GRCm39) missense probably damaging 1.00
R1171:Dchs1 UTSW 7 105,406,921 (GRCm39) missense probably benign
R1241:Dchs1 UTSW 7 105,407,385 (GRCm39) missense probably damaging 1.00
R1389:Dchs1 UTSW 7 105,404,778 (GRCm39) missense probably benign 0.40
R1427:Dchs1 UTSW 7 105,415,398 (GRCm39) missense probably benign 0.06
R1458:Dchs1 UTSW 7 105,404,451 (GRCm39) missense probably damaging 1.00
R1513:Dchs1 UTSW 7 105,421,278 (GRCm39) nonsense probably null
R1524:Dchs1 UTSW 7 105,413,732 (GRCm39) missense probably damaging 1.00
R1525:Dchs1 UTSW 7 105,408,138 (GRCm39) missense probably damaging 1.00
R1534:Dchs1 UTSW 7 105,421,247 (GRCm39) missense probably damaging 0.98
R1567:Dchs1 UTSW 7 105,421,068 (GRCm39) missense probably benign 0.01
R1577:Dchs1 UTSW 7 105,415,162 (GRCm39) missense probably damaging 1.00
R1603:Dchs1 UTSW 7 105,411,977 (GRCm39) missense probably benign 0.24
R1676:Dchs1 UTSW 7 105,404,128 (GRCm39) missense probably benign 0.40
R1794:Dchs1 UTSW 7 105,420,927 (GRCm39) missense probably benign 0.02
R1826:Dchs1 UTSW 7 105,406,834 (GRCm39) missense probably damaging 1.00
R1892:Dchs1 UTSW 7 105,413,363 (GRCm39) missense probably benign 0.00
R1924:Dchs1 UTSW 7 105,421,487 (GRCm39) missense possibly damaging 0.81
R1932:Dchs1 UTSW 7 105,415,109 (GRCm39) missense probably damaging 1.00
R1962:Dchs1 UTSW 7 105,413,408 (GRCm39) missense probably damaging 1.00
R1985:Dchs1 UTSW 7 105,421,605 (GRCm39) missense possibly damaging 0.72
R1993:Dchs1 UTSW 7 105,411,755 (GRCm39) missense probably benign 0.00
R2007:Dchs1 UTSW 7 105,404,532 (GRCm39) missense probably damaging 1.00
R2316:Dchs1 UTSW 7 105,413,411 (GRCm39) missense possibly damaging 0.71
R2351:Dchs1 UTSW 7 105,403,301 (GRCm39) missense probably benign
R2474:Dchs1 UTSW 7 105,404,281 (GRCm39) missense probably benign 0.37
R2474:Dchs1 UTSW 7 105,422,045 (GRCm39) missense probably damaging 1.00
R3429:Dchs1 UTSW 7 105,405,711 (GRCm39) missense possibly damaging 0.85
R3430:Dchs1 UTSW 7 105,405,711 (GRCm39) missense possibly damaging 0.85
R3737:Dchs1 UTSW 7 105,411,523 (GRCm39) missense possibly damaging 0.88
R3767:Dchs1 UTSW 7 105,406,292 (GRCm39) missense possibly damaging 0.67
R3874:Dchs1 UTSW 7 105,410,842 (GRCm39) missense probably damaging 1.00
R3883:Dchs1 UTSW 7 105,411,770 (GRCm39) missense probably damaging 1.00
R4105:Dchs1 UTSW 7 105,414,347 (GRCm39) missense probably damaging 1.00
R4209:Dchs1 UTSW 7 105,415,397 (GRCm39) missense probably damaging 0.99
R4329:Dchs1 UTSW 7 105,402,966 (GRCm39) missense probably damaging 1.00
R4516:Dchs1 UTSW 7 105,404,059 (GRCm39) missense probably damaging 1.00
R4579:Dchs1 UTSW 7 105,408,180 (GRCm39) missense probably benign
R4579:Dchs1 UTSW 7 105,403,972 (GRCm39) missense probably damaging 1.00
R4588:Dchs1 UTSW 7 105,405,248 (GRCm39) missense probably benign
R4613:Dchs1 UTSW 7 105,421,931 (GRCm39) missense probably damaging 1.00
R4632:Dchs1 UTSW 7 105,403,562 (GRCm39) missense probably benign 0.02
R4696:Dchs1 UTSW 7 105,413,834 (GRCm39) missense probably damaging 1.00
R4725:Dchs1 UTSW 7 105,414,759 (GRCm39) missense probably damaging 1.00
R4725:Dchs1 UTSW 7 105,404,460 (GRCm39) missense probably damaging 0.98
R4738:Dchs1 UTSW 7 105,407,880 (GRCm39) missense probably damaging 0.96
R4768:Dchs1 UTSW 7 105,420,827 (GRCm39) missense possibly damaging 0.96
R4784:Dchs1 UTSW 7 105,415,133 (GRCm39) missense probably damaging 1.00
R4864:Dchs1 UTSW 7 105,404,460 (GRCm39) missense probably damaging 0.98
R4880:Dchs1 UTSW 7 105,404,937 (GRCm39) missense probably benign 0.00
R4909:Dchs1 UTSW 7 105,415,462 (GRCm39) missense probably damaging 1.00
R5102:Dchs1 UTSW 7 105,421,384 (GRCm39) missense probably benign 0.09
R5109:Dchs1 UTSW 7 105,414,221 (GRCm39) missense probably benign
R5126:Dchs1 UTSW 7 105,402,724 (GRCm39) missense probably damaging 1.00
R5149:Dchs1 UTSW 7 105,404,865 (GRCm39) missense probably damaging 0.98
R5330:Dchs1 UTSW 7 105,403,809 (GRCm39) missense probably damaging 1.00
R5384:Dchs1 UTSW 7 105,421,262 (GRCm39) missense probably damaging 1.00
R5384:Dchs1 UTSW 7 105,407,236 (GRCm39) missense probably damaging 1.00
R5386:Dchs1 UTSW 7 105,407,236 (GRCm39) missense probably damaging 1.00
R5622:Dchs1 UTSW 7 105,404,500 (GRCm39) missense probably benign 0.11
R5623:Dchs1 UTSW 7 105,421,976 (GRCm39) missense probably damaging 1.00
R5708:Dchs1 UTSW 7 105,422,016 (GRCm39) missense probably damaging 1.00
R5718:Dchs1 UTSW 7 105,404,955 (GRCm39) missense probably benign 0.01
R5743:Dchs1 UTSW 7 105,420,803 (GRCm39) missense probably benign
R5759:Dchs1 UTSW 7 105,413,383 (GRCm39) missense probably damaging 0.99
R5772:Dchs1 UTSW 7 105,422,247 (GRCm39) missense probably damaging 1.00
R5860:Dchs1 UTSW 7 105,421,242 (GRCm39) missense probably damaging 1.00
R5916:Dchs1 UTSW 7 105,408,373 (GRCm39) missense probably damaging 1.00
R5965:Dchs1 UTSW 7 105,405,132 (GRCm39) missense probably damaging 1.00
R5997:Dchs1 UTSW 7 105,403,302 (GRCm39) missense probably benign 0.08
R6065:Dchs1 UTSW 7 105,404,628 (GRCm39) missense probably damaging 1.00
R6136:Dchs1 UTSW 7 105,410,132 (GRCm39) missense probably benign
R6137:Dchs1 UTSW 7 105,414,313 (GRCm39) missense probably damaging 0.99
R6324:Dchs1 UTSW 7 105,414,145 (GRCm39) missense probably benign 0.05
R6363:Dchs1 UTSW 7 105,407,679 (GRCm39) missense probably benign 0.12
R6466:Dchs1 UTSW 7 105,413,748 (GRCm39) missense probably benign 0.09
R6544:Dchs1 UTSW 7 105,407,385 (GRCm39) missense probably damaging 1.00
R6572:Dchs1 UTSW 7 105,408,013 (GRCm39) missense possibly damaging 0.94
R6579:Dchs1 UTSW 7 105,412,120 (GRCm39) missense probably benign 0.17
R6632:Dchs1 UTSW 7 105,411,085 (GRCm39) missense probably damaging 1.00
R6725:Dchs1 UTSW 7 105,408,000 (GRCm39) missense probably damaging 0.99
R6789:Dchs1 UTSW 7 105,406,210 (GRCm39) missense possibly damaging 0.61
R6868:Dchs1 UTSW 7 105,412,710 (GRCm39) missense possibly damaging 0.91
R7058:Dchs1 UTSW 7 105,406,228 (GRCm39) missense probably benign
R7064:Dchs1 UTSW 7 105,412,392 (GRCm39) missense probably damaging 0.99
R7076:Dchs1 UTSW 7 105,411,078 (GRCm39) missense probably benign 0.04
R7191:Dchs1 UTSW 7 105,414,646 (GRCm39) missense possibly damaging 0.89
R7298:Dchs1 UTSW 7 105,404,338 (GRCm39) nonsense probably null
R7380:Dchs1 UTSW 7 105,407,835 (GRCm39) missense probably benign 0.35
R7438:Dchs1 UTSW 7 105,404,155 (GRCm39) missense probably benign 0.30
R7496:Dchs1 UTSW 7 105,411,066 (GRCm39) missense probably damaging 1.00
R7534:Dchs1 UTSW 7 105,421,580 (GRCm39) missense probably benign 0.00
R7604:Dchs1 UTSW 7 105,415,189 (GRCm39) missense probably damaging 1.00
R7631:Dchs1 UTSW 7 105,408,445 (GRCm39) missense probably benign
R7821:Dchs1 UTSW 7 105,414,352 (GRCm39) missense probably benign 0.00
R7834:Dchs1 UTSW 7 105,414,774 (GRCm39) missense probably benign 0.39
R7841:Dchs1 UTSW 7 105,412,180 (GRCm39) missense probably benign
R7913:Dchs1 UTSW 7 105,408,435 (GRCm39) missense possibly damaging 0.61
R8041:Dchs1 UTSW 7 105,404,395 (GRCm39) missense probably benign 0.45
R8076:Dchs1 UTSW 7 105,411,189 (GRCm39) missense probably damaging 1.00
R8076:Dchs1 UTSW 7 105,405,128 (GRCm39) missense possibly damaging 0.52
R8087:Dchs1 UTSW 7 105,402,706 (GRCm39) missense probably benign 0.41
R8125:Dchs1 UTSW 7 105,414,089 (GRCm39) missense possibly damaging 0.91
R8223:Dchs1 UTSW 7 105,411,824 (GRCm39) missense possibly damaging 0.81
R8239:Dchs1 UTSW 7 105,414,718 (GRCm39) missense probably benign 0.22
R8476:Dchs1 UTSW 7 105,408,015 (GRCm39) missense probably benign 0.05
R8497:Dchs1 UTSW 7 105,408,168 (GRCm39) missense probably damaging 1.00
R8770:Dchs1 UTSW 7 105,420,945 (GRCm39) missense probably damaging 1.00
R8856:Dchs1 UTSW 7 105,410,064 (GRCm39) missense probably damaging 1.00
R8866:Dchs1 UTSW 7 105,404,597 (GRCm39) missense probably benign 0.00
R8948:Dchs1 UTSW 7 105,408,212 (GRCm39) missense probably benign 0.30
R8950:Dchs1 UTSW 7 105,408,212 (GRCm39) missense probably benign 0.30
R9029:Dchs1 UTSW 7 105,402,919 (GRCm39) missense probably benign 0.13
R9039:Dchs1 UTSW 7 105,405,215 (GRCm39) missense probably benign 0.11
R9134:Dchs1 UTSW 7 105,404,910 (GRCm39) missense probably damaging 0.96
R9159:Dchs1 UTSW 7 105,415,126 (GRCm39) missense probably benign
R9162:Dchs1 UTSW 7 105,414,732 (GRCm39) missense probably damaging 1.00
R9169:Dchs1 UTSW 7 105,422,114 (GRCm39) missense probably damaging 1.00
R9262:Dchs1 UTSW 7 105,404,833 (GRCm39) missense probably damaging 1.00
R9292:Dchs1 UTSW 7 105,403,120 (GRCm39) missense probably damaging 1.00
R9325:Dchs1 UTSW 7 105,415,402 (GRCm39) missense possibly damaging 0.51
R9376:Dchs1 UTSW 7 105,414,981 (GRCm39) critical splice donor site probably null
R9392:Dchs1 UTSW 7 105,421,869 (GRCm39) missense probably benign 0.09
R9619:Dchs1 UTSW 7 105,413,662 (GRCm39) missense probably benign 0.07
R9680:Dchs1 UTSW 7 105,411,625 (GRCm39) missense probably damaging 1.00
R9687:Dchs1 UTSW 7 105,407,191 (GRCm39) missense probably damaging 0.99
R9747:Dchs1 UTSW 7 105,412,682 (GRCm39) missense probably damaging 1.00
Z1177:Dchs1 UTSW 7 105,406,900 (GRCm39) missense probably damaging 1.00
Z1177:Dchs1 UTSW 7 105,407,758 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2021-11-19