Mutagenetix > Incidental Mutation

Incidental Mutation 'R9081:Nol8'

690038

Institutional Source

Beutler Lab

Gene Symbol

Nol8

Ensembl Gene

ENSMUSG00000021392

Gene Name

nucleolar protein 8

Synonyms

5730412B09Rik, D13Ertd548e, 4921532D18Rik

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R9081 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

49653078-49679016 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 49661405 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Leucine at position 330 (M330L)

Ref Sequence

ENSEMBL: ENSMUSP00000152536 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021824] [ENSMUST00000221083] [ENSMUST00000221142] [ENSMUST00000222197] [ENSMUST00000222333] [ENSMUST00000223264] [ENSMUST00000223467]

AlphaFold

Q3UHX0

Predicted Effect

probably benign
Transcript: ENSMUST00000021824
AA Change: M330L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000021824
Gene: ENSMUSG00000021392
AA Change: M330L

Domain	Start	End	E-Value	Type
RRM	27	103	3.02e-9	SMART
low complexity region	315	327	N/A	INTRINSIC
low complexity region	454	468	N/A	INTRINSIC
low complexity region	712	724	N/A	INTRINSIC
low complexity region	804	816	N/A	INTRINSIC
low complexity region	836	849	N/A	INTRINSIC
coiled coil region	886	916	N/A	INTRINSIC
coiled coil region	955	981	N/A	INTRINSIC
low complexity region	1080	1093	N/A	INTRINSIC
low complexity region	1152	1164	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000221083

Predicted Effect

probably benign
Transcript: ENSMUST00000221142
AA Change: M312L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

Predicted Effect

probably benign
Transcript: ENSMUST00000222197
AA Change: M330L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

Predicted Effect

probably benign
Transcript: ENSMUST00000222333

Predicted Effect

probably benign
Transcript: ENSMUST00000223264

Predicted Effect

probably benign
Transcript: ENSMUST00000223467
AA Change: M312L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

100% (71/71)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NOL8 binds Ras-related GTP-binding proteins (see MIM 608267) and plays a role in cell growth (Sekiguchi et al., 2004 [PubMed 14660641]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aaas	A	T	15: 102,340,067	V271E	probably damaging	Het
Abca1	A	G	4: 53,109,162		probably null	Het
Abcb11	C	T	2: 69,292,044	C365Y	possibly damaging	Het
Abcd2	A	T	15: 91,191,569	W14R	probably damaging	Het
Acmsd	A	G	1: 127,759,731	D250G	possibly damaging	Het
Ahnak	T	A	19: 9,008,526	D2391E	possibly damaging	Het
Apol11b	C	T	15: 77,640,571	E5K	possibly damaging	Het
Cbr1	G	T	16: 93,610,106	G237*	probably null	Het
Cdr2l	T	A	11: 115,394,113	V425E	probably damaging	Het
Chd9	A	T	8: 90,977,516	K693*	probably null	Het
Clgn	T	G	8: 83,426,540	D590E	probably damaging	Het
Col14a1	T	A	15: 55,427,991	S952T	unknown	Het
Crip3	T	C	17: 46,430,033	L90P	probably benign	Het
Dchs1	A	G	7: 105,754,429	S2969P	probably benign	Het
Dnaic2	T	A	11: 114,738,667	D173E	probably damaging	Het
Dnpep	A	T	1: 75,314,416	F257Y	probably damaging	Het
Egln2	A	G	7: 27,164,861	V213A	probably benign	Het
Epha8	G	T	4: 136,938,586	L420M	probably damaging	Het
Eps8	A	G	6: 137,527,417	I106T	probably benign	Het
Evi5	A	G	5: 107,815,705	F379L	probably benign	Het
Fbxo31	G	A	8: 121,554,397	R337C	probably damaging	Het
Fpgs	A	T	2: 32,687,488		probably benign	Het
Garnl3	T	G	2: 33,006,908	D573A	possibly damaging	Het
Gja8	A	G	3: 96,919,360	S329P	probably damaging	Het
Gzf1	T	A	2: 148,683,397		probably benign	Het
Hgs	T	A	11: 120,475,250		probably benign	Het
Ifi203	A	G	1: 173,929,482	I245T	unknown	Het
Ighv1-74	C	A	12: 115,802,834	W55C	probably damaging	Het
Iqcb1	A	G	16: 36,835,644	K131R	probably null	Het
Kdelc1	T	A	1: 44,114,806	Q161L	probably benign	Het
Kit	A	T	5: 75,640,558	M539L	probably benign	Het
Klk1	A	G	7: 44,225,528		probably benign	Het
Krt84	C	T	15: 101,532,379	G126D	unknown	Het
Lama5	A	T	2: 180,192,137	C1473*	probably null	Het
Loxl3	T	C	6: 83,048,657	V332A	possibly damaging	Het
Mcf2l	T	A	8: 13,018,697	Y1120N	probably damaging	Het
Meioc	G	A	11: 102,674,175	V150M	probably benign	Het
Mybpc1	T	G	10: 88,553,306	Y400S	probably damaging	Het
Ncmap	T	C	4: 135,376,981		probably benign	Het
Noc2l	A	G	4: 156,241,767	Y437C	probably damaging	Het
Olfr1467	C	T	19: 13,364,655	T9I	probably benign	Het
Olfr961	A	T	9: 39,646,900	Y58F	probably damaging	Het
P4ha1	T	C	10: 59,348,363	Y216H	probably damaging	Het
Pamr1	A	T	2: 102,611,588	D174V	probably damaging	Het
Pdcd1	C	T	1: 94,041,155		probably null	Het
Plec	A	G	15: 76,175,708	V3343A	probably damaging	Het
Pnliprp1	A	T	19: 58,734,974	I266F	probably benign	Het
Ppp1r12b	C	T	1: 134,777,347	V868I	probably benign	Het
Ppp2r2b	A	T	18: 42,648,760	H325Q	probably benign	Het
Rif1	C	T	2: 52,110,977	T1481I	probably damaging	Het
Rnf213	A	T	11: 119,466,236	D4204V		Het
Rps6kl1	T	C	12: 85,139,107	N409S	probably damaging	Het
Rundc1	T	G	11: 101,425,227	W42G	probably damaging	Het
Sec1	C	T	7: 45,684,563		probably benign	Het
Sez6	G	A	11: 77,974,295	E623K	possibly damaging	Het
Shc2	T	C	10: 79,626,928		probably null	Het
Slc19a1	T	C	10: 77,041,916	V95A	possibly damaging	Het
Slc22a5	A	T	11: 53,871,621	D333E	probably damaging	Het
Specc1	A	C	11: 62,119,225	R522S	possibly damaging	Het
Syne2	C	T	12: 75,969,516	Q3291*	probably null	Het
Taar7e	G	A	10: 24,037,995	V128I	probably benign	Het
Tdrd3	A	G	14: 87,506,281	N555S	probably benign	Het
Themis	C	T	10: 28,668,586		probably benign	Het
Tjp1	A	G	7: 65,314,262	V945A	possibly damaging	Het
Tom1	G	A	8: 75,051,523	V78I	probably damaging	Het
Usp13	A	G	3: 32,881,393	T323A	probably benign	Het
Usp49	T	C	17: 47,673,311	S414P	possibly damaging	Het
Vmn1r104	G	A	7: 20,534,453	S206N	probably damaging	Het
Vps45	A	T	3: 96,032,813	V446E	probably benign	Het
Wwc1	T	C	11: 35,891,504	K222R	probably benign	Het
Zc3h13	CAGAGACCGGGACAGAAGGAGAGAC	CAGAGAC	14: 75,331,941		probably benign	Het

Other mutations in Nol8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00801:Nol8	APN	13	49662228	missense	probably benign	0.01
IGL01106:Nol8	APN	13	49654481	missense	possibly damaging	0.46
IGL01413:Nol8	APN	13	49659952	missense	possibly damaging	0.82
IGL01540:Nol8	APN	13	49661670	missense	probably benign	0.06
IGL01670:Nol8	APN	13	49661308	missense	possibly damaging	0.54
IGL01672:Nol8	APN	13	49675407	missense	possibly damaging	0.95
IGL02032:Nol8	APN	13	49672772	missense	probably benign
IGL02212:Nol8	APN	13	49662150	missense	possibly damaging	0.87
IGL02323:Nol8	APN	13	49655245	splice site	probably benign
IGL02645:Nol8	APN	13	49665471	critical splice donor site	probably null
IGL02949:Nol8	APN	13	49662402	missense	probably benign	0.01
IGL02954:Nol8	APN	13	49661172	missense	probably benign	0.01
IGL03182:Nol8	APN	13	49664081	missense	probably damaging	1.00
IGL03406:Nol8	APN	13	49661568	missense	probably damaging	1.00
P0047:Nol8	UTSW	13	49654348	splice site	probably null
R0092:Nol8	UTSW	13	49662447	missense	possibly damaging	0.54
R0099:Nol8	UTSW	13	49672689	missense	probably benign
R0145:Nol8	UTSW	13	49662447	missense	possibly damaging	0.54
R0269:Nol8	UTSW	13	49654445	missense	possibly damaging	0.49
R0370:Nol8	UTSW	13	49662447	missense	possibly damaging	0.54
R0374:Nol8	UTSW	13	49662447	missense	possibly damaging	0.54
R0390:Nol8	UTSW	13	49662152	missense	probably damaging	1.00
R0617:Nol8	UTSW	13	49654445	missense	possibly damaging	0.49
R0635:Nol8	UTSW	13	49676758	missense	probably benign	0.05
R0637:Nol8	UTSW	13	49662447	missense	possibly damaging	0.54
R1246:Nol8	UTSW	13	49676769	missense	probably damaging	1.00
R1446:Nol8	UTSW	13	49655227	missense	probably damaging	1.00
R1464:Nol8	UTSW	13	49676788	missense	probably benign
R1464:Nol8	UTSW	13	49676788	missense	probably benign
R1627:Nol8	UTSW	13	49661504	missense	probably benign	0.01
R1703:Nol8	UTSW	13	49667457	missense	possibly damaging	0.65
R1751:Nol8	UTSW	13	49667408	missense	probably benign	0.06
R2187:Nol8	UTSW	13	49661999	missense	probably benign	0.00
R2357:Nol8	UTSW	13	49654504	critical splice donor site	probably null
R3081:Nol8	UTSW	13	49678392	unclassified	probably benign
R3969:Nol8	UTSW	13	49660016	nonsense	probably null
R4199:Nol8	UTSW	13	49661748	missense	possibly damaging	0.65
R4720:Nol8	UTSW	13	49662753	missense	probably damaging	1.00
R4927:Nol8	UTSW	13	49654425	missense	possibly damaging	0.79
R5177:Nol8	UTSW	13	49661112	missense	probably benign	0.32
R5512:Nol8	UTSW	13	49676787	missense	probably benign
R5744:Nol8	UTSW	13	49662326	missense	possibly damaging	0.82
R5988:Nol8	UTSW	13	49672614	missense	possibly damaging	0.58
R6048:Nol8	UTSW	13	49653684	critical splice donor site	probably null
R6306:Nol8	UTSW	13	49676353	missense	probably damaging	1.00
R6359:Nol8	UTSW	13	49664070	missense	probably benign	0.16
R6378:Nol8	UTSW	13	49667355	missense	probably damaging	1.00
R6655:Nol8	UTSW	13	49654392	missense	probably damaging	1.00
R7035:Nol8	UTSW	13	49661202	missense	probably benign	0.06
R7058:Nol8	UTSW	13	49676386	missense	probably damaging	1.00
R7368:Nol8	UTSW	13	49661219	missense	probably benign	0.00
R7450:Nol8	UTSW	13	49660015	missense	probably benign	0.01
R7673:Nol8	UTSW	13	49664780	missense	probably benign	0.15
R7750:Nol8	UTSW	13	49662266	missense	possibly damaging	0.83
R8246:Nol8	UTSW	13	49655248	splice site	probably benign
R9127:Nol8	UTSW	13	49661999	missense	probably benign	0.00
R9223:Nol8	UTSW	13	49661262	missense	possibly damaging	0.63
X0020:Nol8	UTSW	13	49661165	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CCCATGGAGTCCAAGGTTTC -3'
(R):5'- CTGGTTGTGAAGATTCTGCAC -3'

Sequencing Primer
(F):5'- GAGTCCAAGGTTTCTAATATTGGTC -3'
(R):5'- GAAGATTCTGCACTGTTTTTGACC -3'

Posted On

2021-11-19