Incidental Mutation 'R9081:Pnliprp1'
ID 690054
Institutional Source Beutler Lab
Gene Symbol Pnliprp1
Ensembl Gene ENSMUSG00000042179
Gene Name pancreatic lipase related protein 1
Synonyms Plrp1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock # R9081 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 58728887-58744169 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 58734974 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 266 (I266F)
Ref Sequence ENSEMBL: ENSMUSP00000045465 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048644]
AlphaFold Q5BKQ4
Predicted Effect probably benign
Transcript: ENSMUST00000048644
AA Change: I266F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000045465
Gene: ENSMUSG00000042179
AA Change: I266F

DomainStartEndE-ValueType
Pfam:Lipase 18 353 9.1e-157 PFAM
LH2 356 467 1.98e-17 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aaas A T 15: 102,340,067 V271E probably damaging Het
Abca1 A G 4: 53,109,162 probably null Het
Abcb11 C T 2: 69,292,044 C365Y possibly damaging Het
Abcd2 A T 15: 91,191,569 W14R probably damaging Het
Acmsd A G 1: 127,759,731 D250G possibly damaging Het
Ahnak T A 19: 9,008,526 D2391E possibly damaging Het
Apol11b C T 15: 77,640,571 E5K possibly damaging Het
Cbr1 G T 16: 93,610,106 G237* probably null Het
Cdr2l T A 11: 115,394,113 V425E probably damaging Het
Chd9 A T 8: 90,977,516 K693* probably null Het
Clgn T G 8: 83,426,540 D590E probably damaging Het
Col14a1 T A 15: 55,427,991 S952T unknown Het
Crip3 T C 17: 46,430,033 L90P probably benign Het
Dchs1 A G 7: 105,754,429 S2969P probably benign Het
Dnaic2 T A 11: 114,738,667 D173E probably damaging Het
Dnpep A T 1: 75,314,416 F257Y probably damaging Het
Egln2 A G 7: 27,164,861 V213A probably benign Het
Epha8 G T 4: 136,938,586 L420M probably damaging Het
Eps8 A G 6: 137,527,417 I106T probably benign Het
Evi5 A G 5: 107,815,705 F379L probably benign Het
Fbxo31 G A 8: 121,554,397 R337C probably damaging Het
Garnl3 T G 2: 33,006,908 D573A possibly damaging Het
Gja8 A G 3: 96,919,360 S329P probably damaging Het
Ifi203 A G 1: 173,929,482 I245T unknown Het
Ighv1-74 C A 12: 115,802,834 W55C probably damaging Het
Iqcb1 A G 16: 36,835,644 K131R probably null Het
Kdelc1 T A 1: 44,114,806 Q161L probably benign Het
Kit A T 5: 75,640,558 M539L probably benign Het
Krt84 C T 15: 101,532,379 G126D unknown Het
Lama5 A T 2: 180,192,137 C1473* probably null Het
Loxl3 T C 6: 83,048,657 V332A possibly damaging Het
Mcf2l T A 8: 13,018,697 Y1120N probably damaging Het
Meioc G A 11: 102,674,175 V150M probably benign Het
Mybpc1 T G 10: 88,553,306 Y400S probably damaging Het
Noc2l A G 4: 156,241,767 Y437C probably damaging Het
Nol8 A T 13: 49,661,405 M330L probably benign Het
Olfr1467 C T 19: 13,364,655 T9I probably benign Het
Olfr961 A T 9: 39,646,900 Y58F probably damaging Het
P4ha1 T C 10: 59,348,363 Y216H probably damaging Het
Pamr1 A T 2: 102,611,588 D174V probably damaging Het
Pdcd1 C T 1: 94,041,155 probably null Het
Plec A G 15: 76,175,708 V3343A probably damaging Het
Ppp1r12b C T 1: 134,777,347 V868I probably benign Het
Ppp2r2b A T 18: 42,648,760 H325Q probably benign Het
Rif1 C T 2: 52,110,977 T1481I probably damaging Het
Rnf213 A T 11: 119,466,236 D4204V Het
Rps6kl1 T C 12: 85,139,107 N409S probably damaging Het
Rundc1 T G 11: 101,425,227 W42G probably damaging Het
Sez6 G A 11: 77,974,295 E623K possibly damaging Het
Shc2 T C 10: 79,626,928 probably null Het
Slc19a1 T C 10: 77,041,916 V95A possibly damaging Het
Slc22a5 A T 11: 53,871,621 D333E probably damaging Het
Specc1 A C 11: 62,119,225 R522S possibly damaging Het
Syne2 C T 12: 75,969,516 Q3291* probably null Het
Taar7e G A 10: 24,037,995 V128I probably benign Het
Tdrd3 A G 14: 87,506,281 N555S probably benign Het
Themis C T 10: 28,668,586 probably benign Het
Tjp1 A G 7: 65,314,262 V945A possibly damaging Het
Tom1 G A 8: 75,051,523 V78I probably damaging Het
Usp13 A G 3: 32,881,393 T323A probably benign Het
Usp49 T C 17: 47,673,311 S414P possibly damaging Het
Vmn1r104 G A 7: 20,534,453 S206N probably damaging Het
Vps45 A T 3: 96,032,813 V446E probably benign Het
Wwc1 T C 11: 35,891,504 K222R probably benign Het
Zc3h13 CAGAGACCGGGACAGAAGGAGAGAC CAGAGAC 14: 75,331,941 probably benign Het
Other mutations in Pnliprp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Pnliprp1 APN 19 58734730 missense probably damaging 1.00
IGL02367:Pnliprp1 APN 19 58738169 missense probably benign
R0463:Pnliprp1 UTSW 19 58738196 nonsense probably null
R0573:Pnliprp1 UTSW 19 58734882 missense possibly damaging 0.89
R0591:Pnliprp1 UTSW 19 58734706 missense probably damaging 1.00
R0608:Pnliprp1 UTSW 19 58738196 nonsense probably null
R1169:Pnliprp1 UTSW 19 58734951 missense probably damaging 1.00
R1575:Pnliprp1 UTSW 19 58740469 missense probably benign 0.07
R1723:Pnliprp1 UTSW 19 58732142 missense possibly damaging 0.79
R1879:Pnliprp1 UTSW 19 58744084 missense probably benign 0.07
R1955:Pnliprp1 UTSW 19 58734972 missense possibly damaging 0.94
R2090:Pnliprp1 UTSW 19 58740469 missense probably benign 0.03
R2092:Pnliprp1 UTSW 19 58741184 missense probably benign 0.02
R2342:Pnliprp1 UTSW 19 58741259 splice site probably benign
R2421:Pnliprp1 UTSW 19 58744085 missense probably benign 0.21
R4716:Pnliprp1 UTSW 19 58740469 missense possibly damaging 0.61
R5463:Pnliprp1 UTSW 19 58734736 missense probably damaging 1.00
R5478:Pnliprp1 UTSW 19 58734991 splice site probably null
R6155:Pnliprp1 UTSW 19 58730133 critical splice donor site probably null
R6284:Pnliprp1 UTSW 19 58734984 missense probably damaging 1.00
R7107:Pnliprp1 UTSW 19 58729150 missense probably damaging 1.00
R7454:Pnliprp1 UTSW 19 58741100 missense probably benign 0.29
R7470:Pnliprp1 UTSW 19 58732025 missense possibly damaging 0.48
R7574:Pnliprp1 UTSW 19 58738249 missense probably damaging 1.00
R7601:Pnliprp1 UTSW 19 58732094 missense probably damaging 0.99
R8782:Pnliprp1 UTSW 19 58730593 missense probably damaging 1.00
R9466:Pnliprp1 UTSW 19 58734649 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGGATGTTTTAACCCTAAGAGC -3'
(R):5'- TGCATCGTGTCTAAGGAAAGAC -3'

Sequencing Primer
(F):5'- GATGTTTTAACCCTAAGAGCCCTGTG -3'
(R):5'- TACGCATCCTTACATAGACAGCAG -3'
Posted On 2021-11-19