Incidental Mutation 'R8927:Spon1'
ID 690157
Institutional Source Beutler Lab
Gene Symbol Spon1
Ensembl Gene ENSMUSG00000038156
Gene Name spondin 1, (f-spondin) extracellular matrix protein
Synonyms FSP, D330035F22Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.239) question?
Stock # R8927 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 113765998-114043370 bp(+) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 114030357 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000041157 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046687] [ENSMUST00000046687]
AlphaFold Q8VCC9
Predicted Effect probably null
Transcript: ENSMUST00000046687
SMART Domains Protein: ENSMUSP00000041157
Gene: ENSMUSG00000038156

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:Reeler 44 172 1e-24 PFAM
Pfam:Spond_N 205 399 7.5e-74 PFAM
low complexity region 431 442 N/A INTRINSIC
TSP1 445 495 7.92e-8 SMART
TSP1 504 555 6.57e-14 SMART
TSP1 561 611 2.29e-13 SMART
TSP1 617 666 1.45e-15 SMART
TSP1 671 721 1.21e-12 SMART
low complexity region 730 747 N/A INTRINSIC
TSP1 757 806 3.12e-6 SMART
Predicted Effect probably null
Transcript: ENSMUST00000046687
SMART Domains Protein: ENSMUSP00000041157
Gene: ENSMUSG00000038156

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:Reeler 44 172 1e-24 PFAM
Pfam:Spond_N 205 399 7.5e-74 PFAM
low complexity region 431 442 N/A INTRINSIC
TSP1 445 495 7.92e-8 SMART
TSP1 504 555 6.57e-14 SMART
TSP1 561 611 2.29e-13 SMART
TSP1 617 666 1.45e-15 SMART
TSP1 671 721 1.21e-12 SMART
low complexity region 730 747 N/A INTRINSIC
TSP1 757 806 3.12e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele display increased trabecular and cortical bone mass. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A T 4: 42,972,251 Y528F probably benign Het
A630089N07Rik A T 16: 98,066,167 H198Q probably damaging Het
Abcb9 T C 5: 124,083,643 T223A probably benign Het
Actc1 T A 2: 114,050,400 K115* probably null Het
Angptl2 G A 2: 33,242,304 D308N probably benign Het
Arl4d A C 11: 101,667,066 Q139H possibly damaging Het
Aspm T A 1: 139,490,387 C2951* probably null Het
Atp23 A T 10: 126,887,493 *247R probably null Het
B3gnt7 T A 1: 86,305,117 S28R probably benign Het
Bmp7 C T 2: 172,879,418 R288H probably damaging Het
Bsdc1 G T 4: 129,461,646 probably benign Het
C130060K24Rik C A 6: 65,381,613 S107* probably null Het
Ccdc146 T C 5: 21,333,062 E88G probably damaging Het
Ccdc73 C A 2: 104,992,197 D2E Het
Cdc5l C A 17: 45,410,913 R477L Het
Cdh22 T A 2: 165,123,584 H529L possibly damaging Het
Chchd3 T A 6: 32,804,016 E178D probably benign Het
Ciz1 A T 2: 32,367,500 R186* probably null Het
Copa T A 1: 172,104,170 H329Q probably null Het
Dcaf7 A G 11: 106,051,926 D233G probably damaging Het
Dclk2 G T 3: 86,831,741 P317Q probably damaging Het
Dsc3 A T 18: 19,974,177 H462Q probably benign Het
Fn1 T C 1: 71,599,376 N1998S probably benign Het
Fpr2 T C 17: 17,893,462 L240S possibly damaging Het
Fzd9 A T 5: 135,249,735 M432K probably damaging Het
Gm14025 A G 2: 129,040,869 S76P Het
Gm15922 A C 7: 3,739,359 N56K probably benign Het
Gm37596 T A 3: 93,692,643 T140S probably benign Het
Gm5862 T A 5: 26,021,680 I75F probably damaging Het
Gpr45 T A 1: 43,033,154 V319D probably damaging Het
Hist1h4j T C 13: 21,735,355 V87A possibly damaging Het
Igfn1 T A 1: 135,978,246 R275W probably damaging Het
Inafm1 G A 7: 16,273,055 A79V unknown Het
Itfg1 C T 8: 85,840,791 probably benign Het
Klhl35 T G 7: 99,471,014 I366S probably damaging Het
Lysmd1 A T 3: 95,138,520 I223F probably damaging Het
Mrps30 A G 13: 118,386,669 L189P probably damaging Het
Ms4a4d A C 19: 11,556,210 T152P probably benign Het
Mtcl1 A T 17: 66,448,633 I238K probably benign Het
Musk T C 4: 58,301,638 I132T probably damaging Het
Myh2 A T 11: 67,188,683 M989L probably benign Het
Myh8 G A 11: 67,283,255 R172H probably benign Het
Nt5c1a C T 4: 123,208,488 T69M possibly damaging Het
Nuak2 T A 1: 132,328,178 D196E probably damaging Het
Olfr1020 A T 2: 85,849,574 I41F possibly damaging Het
Olfr1055 T C 2: 86,347,746 T7A possibly damaging Het
Olfr1086 T C 2: 86,677,286 T16A probably benign Het
Olfr652 A T 7: 104,565,022 H267L probably damaging Het
Palb2 A T 7: 122,124,598 C643S probably damaging Het
Pde5a T A 3: 122,839,600 I706N probably damaging Het
Pdlim4 T C 11: 54,059,964 R100G probably benign Het
Pip5k1c T A 10: 81,293,072 V5E possibly damaging Het
Plekhm1 A G 11: 103,377,213 V644A probably benign Het
Plk2 T G 13: 110,399,216 V524G probably damaging Het
Ppl T A 16: 5,087,610 N1607I probably benign Het
Prag1 T G 8: 36,147,206 V1304G probably damaging Het
Prex1 C T 2: 166,585,075 V1077M probably damaging Het
Prmt6 T C 3: 110,250,932 S14G probably benign Het
Psrc1 T G 3: 108,386,657 S263R probably damaging Het
Rbp7 A T 4: 149,453,501 L36* probably null Het
Rgs12 G T 5: 34,966,289 W472L possibly damaging Het
Rrp8 C A 7: 105,734,866 C143F possibly damaging Het
Sart1 T C 19: 5,388,501 S43G probably benign Het
Setx A G 2: 29,126,959 T25A possibly damaging Het
Skint5 G A 4: 113,483,902 T1414I probably benign Het
Sorbs2 T A 8: 45,795,915 S734R probably damaging Het
Sptbn1 C T 11: 30,138,962 V767I probably damaging Het
Srf T C 17: 46,549,169 I477V probably damaging Het
Tanc2 A G 11: 105,810,505 Y282C probably damaging Het
Tbc1d23 A G 16: 57,171,789 Y603H probably damaging Het
Tfap4 T C 16: 4,551,354 D134G probably damaging Het
Tmem200c A G 17: 68,841,738 T439A probably benign Het
Tmem63b A T 17: 45,664,982 M515K probably damaging Het
Tnc A T 4: 64,007,358 N980K probably damaging Het
Ttc23l T A 15: 10,530,634 L297F probably damaging Het
Vmn1r170 A G 7: 23,606,389 N72S possibly damaging Het
Vmn2r8 T C 5: 108,802,265 M239V Het
Vopp1 A G 6: 57,754,593 F138L probably damaging Het
Vps41 T A 13: 18,745,331 F79I probably benign Het
Zfp317 T C 9: 19,641,225 M1T probably null Het
Other mutations in Spon1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01359:Spon1 APN 7 114034290 missense probably damaging 1.00
IGL02385:Spon1 APN 7 113766330 start codon destroyed probably null 0.56
IGL02496:Spon1 APN 7 114036662 missense probably benign 0.00
IGL02562:Spon1 APN 7 114036761 missense probably benign 0.12
IGL03063:Spon1 APN 7 114033025 missense possibly damaging 0.85
IGL03153:Spon1 APN 7 114030344 missense probably damaging 1.00
IGL03392:Spon1 APN 7 114034287 missense probably damaging 0.99
Rust UTSW 7 114016791 missense possibly damaging 0.77
Wilt UTSW 7 113766384 missense probably damaging 0.98
R0512:Spon1 UTSW 7 113836833 missense possibly damaging 0.59
R0646:Spon1 UTSW 7 114039821 missense probably benign 0.04
R1194:Spon1 UTSW 7 113886798 missense probably benign
R1832:Spon1 UTSW 7 114016785 missense probably benign 0.26
R2391:Spon1 UTSW 7 113886847 missense probably damaging 1.00
R3747:Spon1 UTSW 7 113766384 missense probably damaging 0.98
R3747:Spon1 UTSW 7 114016791 missense possibly damaging 0.77
R3749:Spon1 UTSW 7 113766384 missense probably damaging 0.98
R3749:Spon1 UTSW 7 114016791 missense possibly damaging 0.77
R3750:Spon1 UTSW 7 113766384 missense probably damaging 0.98
R3750:Spon1 UTSW 7 114016791 missense possibly damaging 0.77
R4666:Spon1 UTSW 7 114028969 missense probably benign 0.20
R4730:Spon1 UTSW 7 114033071 missense possibly damaging 0.92
R4774:Spon1 UTSW 7 114039867 missense probably damaging 0.99
R5855:Spon1 UTSW 7 114029072 missense probably damaging 0.99
R5870:Spon1 UTSW 7 114031786 missense probably damaging 1.00
R5914:Spon1 UTSW 7 114030821 missense probably damaging 1.00
R6523:Spon1 UTSW 7 113886785 missense probably benign 0.00
R7138:Spon1 UTSW 7 114036710 missense probably damaging 1.00
R7295:Spon1 UTSW 7 114030240 missense possibly damaging 0.85
R7844:Spon1 UTSW 7 114030332 missense probably benign 0.01
R8064:Spon1 UTSW 7 114036621 missense probably damaging 1.00
R8075:Spon1 UTSW 7 114016793 critical splice donor site probably null
R8928:Spon1 UTSW 7 114030357 critical splice donor site probably null
R9278:Spon1 UTSW 7 114028953 missense probably damaging 1.00
Z1088:Spon1 UTSW 7 113766386 missense possibly damaging 0.83
Z1176:Spon1 UTSW 7 113927794 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGTTTTCACACTGTATTTCCCACG -3'
(R):5'- CTGACCATGGCAGACATTAGC -3'

Sequencing Primer
(F):5'- ACGTTGTCTGTTTTATTCCTGCAG -3'
(R):5'- CTGACCATGGCAGACATTAGCAATTG -3'
Posted On 2021-11-19