Incidental Mutation 'R8932:Col6a1'
ID 690237
Institutional Source Beutler Lab
Gene Symbol Col6a1
Ensembl Gene ENSMUSG00000001119
Gene Name collagen, type VI, alpha 1
Synonyms Col6a-1
MMRRC Submission 068776-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.229) question?
Stock # R8932 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 76544626-76561878 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 76552593 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Leucine at position 431 (P431L)
Ref Sequence ENSEMBL: ENSMUSP00000001147 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001147]
AlphaFold Q04857
Predicted Effect unknown
Transcript: ENSMUST00000001147
AA Change: P431L
SMART Domains Protein: ENSMUSP00000001147
Gene: ENSMUSG00000001119
AA Change: P431L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
VWA 34 232 9.55e-29 SMART
Pfam:Collagen 252 312 5.6e-11 PFAM
Pfam:Collagen 292 367 2e-9 PFAM
Pfam:Collagen 345 423 3.6e-8 PFAM
Pfam:Collagen 448 515 1.1e-8 PFAM
Pfam:Collagen 499 563 1.9e-9 PFAM
low complexity region 571 590 N/A INTRINSIC
VWA 612 798 8.57e-31 SMART
VWA 824 1005 2.6e-30 SMART
Meta Mutation Damage Score 0.1319 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The collagens are a superfamily of proteins that play a role in maintaining the integrity of various tissues. Collagens are extracellular matrix proteins and have a triple-helical domain as their common structural element. Collagen VI is a major structural component of microfibrils. The basic structural unit of collagen VI is a heterotrimer of the alpha1(VI), alpha2(VI), and alpha3(VI) chains. The alpha2(VI) and alpha3(VI) chains are encoded by the COL6A2 and COL6A3 genes, respectively. The protein encoded by this gene is the alpha 1 subunit of type VI collagen (alpha1(VI) chain). Mutations in the genes that code for the collagen VI subunits result in the autosomal dominant disorder, Bethlem myopathy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for this targeted mutation display a myopathic disorder that resembles human Bethlem myopathy. Loss of contractile strength in affected muscles is associated with an unexpected latent mitochondrial dysfunction in myofibers, as well as spontaneous apoptosis. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted(5)

Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam34 G T 8: 44,105,192 (GRCm39) T151K probably benign Het
Adnp2 C T 18: 80,185,893 (GRCm39) G27S probably damaging Het
Ank3 A G 10: 69,660,292 (GRCm39) M265V probably benign Het
Aoc1l1 G A 6: 48,952,428 (GRCm39) E118K probably damaging Het
Apoe T C 7: 19,430,597 (GRCm39) D215G possibly damaging Het
Atp5f1b A G 10: 127,924,850 (GRCm39) I438V probably benign Het
Bckdha A G 7: 25,330,436 (GRCm39) S387P probably damaging Het
Camkk1 T C 11: 72,924,734 (GRCm39) F316L probably damaging Het
Carmil1 A G 13: 24,197,179 (GRCm39) Y158H Het
Ccdc148 T C 2: 58,894,054 (GRCm39) R29G probably benign Het
Ccdc39 A G 3: 33,884,274 (GRCm39) V356A probably benign Het
Cdan1 G A 2: 120,561,568 (GRCm39) Q66* probably null Het
Ckap4 A T 10: 84,364,290 (GRCm39) S258T probably benign Het
Col5a2 T C 1: 45,419,306 (GRCm39) D1258G probably benign Het
Cplane1 A G 15: 8,223,859 (GRCm39) Y874C probably damaging Het
Csn1s2a A G 5: 87,933,164 (GRCm39) I138V probably benign Het
Cyp19a1 C T 9: 54,083,861 (GRCm39) G176D probably benign Het
Dnah10 A G 5: 124,878,015 (GRCm39) E2700G possibly damaging Het
Eif3l T A 15: 78,960,006 (GRCm39) Y23* probably null Het
Fam72a A G 1: 131,456,502 (GRCm39) K22E probably benign Het
Golim4 A G 3: 75,805,351 (GRCm39) V258A probably benign Het
Gtf2ird2 C T 5: 134,237,739 (GRCm39) A272V probably benign Het
Hpse T C 5: 100,846,872 (GRCm39) T186A possibly damaging Het
Ift140 A T 17: 25,305,862 (GRCm39) Q816H probably benign Het
Iqca1 A T 1: 90,067,750 (GRCm39) I167N probably damaging Het
Iqgap1 A T 7: 80,401,141 (GRCm39) F515L probably benign Het
Itgb4 G A 11: 115,879,295 (GRCm39) R558H probably benign Het
Kcna10 G A 3: 107,101,419 (GRCm39) D17N probably damaging Het
Kcnj16 A G 11: 110,915,829 (GRCm39) I164V probably damaging Het
Lrrc55 G T 2: 85,026,615 (GRCm39) N136K probably damaging Het
Mdm4 A T 1: 132,940,382 (GRCm39) M50K probably benign Het
Mfge8 A G 7: 78,786,530 (GRCm39) S290P probably damaging Het
Mindy4 G A 6: 55,201,115 (GRCm39) D267N probably benign Het
Mllt10 T A 2: 18,128,617 (GRCm39) S199R probably benign Het
Mms22l T C 4: 24,533,029 (GRCm39) S436P probably damaging Het
Mpped2 A G 2: 106,697,395 (GRCm39) N290S possibly damaging Het
Mrgpra2a A G 7: 47,076,445 (GRCm39) L271P probably benign Het
Myrf T A 19: 10,200,931 (GRCm39) E247D probably benign Het
Ndrg3 A G 2: 156,782,299 (GRCm39) I189T possibly damaging Het
Nenf C T 1: 191,050,148 (GRCm39) E48K probably benign Het
Nlgn2 T A 11: 69,718,994 (GRCm39) N232Y probably damaging Het
Oog2 G T 4: 143,920,685 (GRCm39) M39I probably benign Het
Or9r7 A T 10: 129,962,631 (GRCm39) N98K probably benign Het
Osbpl3 A T 6: 50,304,371 (GRCm39) N461K probably benign Het
P4ha1 A G 10: 59,175,130 (GRCm39) D30G possibly damaging Het
Pappa2 A T 1: 158,590,762 (GRCm39) C1631S probably damaging Het
Pigk A G 3: 152,445,871 (GRCm39) M161V possibly damaging Het
Prdm1 G T 10: 44,317,335 (GRCm39) S496Y probably damaging Het
Prkg2 T C 5: 99,095,299 (GRCm39) N624S possibly damaging Het
Rgs6 A G 12: 83,112,733 (GRCm39) D181G probably damaging Het
Sbf2 A G 7: 110,040,155 (GRCm39) probably null Het
Sbno2 A C 10: 79,898,042 (GRCm39) L728W probably damaging Het
Selenbp2 A T 3: 94,609,793 (GRCm39) I310F probably damaging Het
Shank3 T A 15: 89,432,986 (GRCm39) W1244R possibly damaging Het
Slc34a1 A C 13: 24,004,184 (GRCm39) I395L probably benign Het
Slf1 A T 13: 77,194,693 (GRCm39) D877E probably damaging Het
Smtn T C 11: 3,472,908 (GRCm39) S255G probably benign Het
Tbx2 T A 11: 85,725,533 (GRCm39) D161E probably damaging Het
Tex14 C A 11: 87,324,675 (GRCm39) L26M possibly damaging Het
Traf7 A G 17: 24,731,286 (GRCm39) F249S probably damaging Het
Trpm6 A G 19: 18,815,366 (GRCm39) K1151E possibly damaging Het
Ttc7b A G 12: 100,268,022 (GRCm39) V773A probably benign Het
Ttn G A 2: 76,747,912 (GRCm39) T4379I probably benign Het
Ttn G A 2: 76,602,854 (GRCm39) T18456I probably damaging Het
Ttn G C 2: 76,709,171 (GRCm39) L8703V unknown Het
Ubb T A 11: 62,442,979 (GRCm39) I3N probably damaging Het
Vmn1r209 A T 13: 22,990,343 (GRCm39) W116R probably damaging Het
Vmn1r75 A G 7: 11,614,838 (GRCm39) D190G probably damaging Het
Wdr12 T A 1: 60,130,202 (GRCm39) M70L probably benign Het
Wdr48 C A 9: 119,740,142 (GRCm39) T317K probably damaging Het
Zbtb5 A G 4: 44,993,962 (GRCm39) V474A probably benign Het
Zfp128 C T 7: 12,625,113 (GRCm39) R494C possibly damaging Het
Other mutations in Col6a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:Col6a1 APN 10 76,546,813 (GRCm39) missense unknown
IGL01943:Col6a1 APN 10 76,554,957 (GRCm39) critical splice donor site probably null
IGL02178:Col6a1 APN 10 76,546,909 (GRCm39) missense unknown
IGL02928:Col6a1 APN 10 76,545,500 (GRCm39) missense possibly damaging 0.93
IGL03162:Col6a1 APN 10 76,553,885 (GRCm39) splice site probably benign
P0005:Col6a1 UTSW 10 76,553,163 (GRCm39) splice site probably benign
R0398:Col6a1 UTSW 10 76,545,952 (GRCm39) missense unknown
R0631:Col6a1 UTSW 10 76,545,569 (GRCm39) missense probably benign 0.03
R0698:Col6a1 UTSW 10 76,552,114 (GRCm39) missense unknown
R0699:Col6a1 UTSW 10 76,552,114 (GRCm39) missense unknown
R0848:Col6a1 UTSW 10 76,549,458 (GRCm39) critical splice donor site probably null
R1053:Col6a1 UTSW 10 76,556,800 (GRCm39) missense probably damaging 0.99
R1235:Col6a1 UTSW 10 76,548,158 (GRCm39) missense unknown
R1480:Col6a1 UTSW 10 76,545,752 (GRCm39) missense unknown
R1854:Col6a1 UTSW 10 76,557,783 (GRCm39) missense probably damaging 1.00
R1995:Col6a1 UTSW 10 76,557,790 (GRCm39) missense probably damaging 1.00
R2082:Col6a1 UTSW 10 76,545,430 (GRCm39) missense probably damaging 0.98
R2122:Col6a1 UTSW 10 76,557,332 (GRCm39) missense probably benign 0.10
R2411:Col6a1 UTSW 10 76,546,922 (GRCm39) missense unknown
R3236:Col6a1 UTSW 10 76,547,154 (GRCm39) missense unknown
R3417:Col6a1 UTSW 10 76,548,203 (GRCm39) missense unknown
R3832:Col6a1 UTSW 10 76,546,951 (GRCm39) missense unknown
R3843:Col6a1 UTSW 10 76,547,175 (GRCm39) missense unknown
R3903:Col6a1 UTSW 10 76,547,175 (GRCm39) missense unknown
R3904:Col6a1 UTSW 10 76,547,175 (GRCm39) missense unknown
R4409:Col6a1 UTSW 10 76,557,334 (GRCm39) missense probably benign 0.17
R4418:Col6a1 UTSW 10 76,554,239 (GRCm39) nonsense probably null
R4568:Col6a1 UTSW 10 76,555,031 (GRCm39) intron probably benign
R4579:Col6a1 UTSW 10 76,547,191 (GRCm39) missense unknown
R4661:Col6a1 UTSW 10 76,550,506 (GRCm39) missense unknown
R4945:Col6a1 UTSW 10 76,548,106 (GRCm39) missense unknown
R4958:Col6a1 UTSW 10 76,559,339 (GRCm39) missense probably damaging 1.00
R5101:Col6a1 UTSW 10 76,545,740 (GRCm39) missense unknown
R5440:Col6a1 UTSW 10 76,559,288 (GRCm39) missense probably damaging 1.00
R5924:Col6a1 UTSW 10 76,554,205 (GRCm39) critical splice donor site probably null
R6030:Col6a1 UTSW 10 76,545,700 (GRCm39) missense unknown
R6030:Col6a1 UTSW 10 76,545,700 (GRCm39) missense unknown
R6366:Col6a1 UTSW 10 76,546,804 (GRCm39) missense unknown
R6435:Col6a1 UTSW 10 76,546,957 (GRCm39) missense unknown
R6718:Col6a1 UTSW 10 76,560,884 (GRCm39) missense probably damaging 1.00
R7014:Col6a1 UTSW 10 76,557,277 (GRCm39) missense probably damaging 1.00
R7117:Col6a1 UTSW 10 76,560,843 (GRCm39) missense probably damaging 1.00
R7153:Col6a1 UTSW 10 76,546,175 (GRCm39) splice site probably null
R7183:Col6a1 UTSW 10 76,552,093 (GRCm39) critical splice donor site probably null
R7244:Col6a1 UTSW 10 76,553,242 (GRCm39) nonsense probably null
R7625:Col6a1 UTSW 10 76,549,760 (GRCm39) missense unknown
R7741:Col6a1 UTSW 10 76,545,743 (GRCm39) missense unknown
R7774:Col6a1 UTSW 10 76,545,710 (GRCm39) missense unknown
R7834:Col6a1 UTSW 10 76,545,762 (GRCm39) missense unknown
R8145:Col6a1 UTSW 10 76,559,305 (GRCm39) missense possibly damaging 0.46
R8177:Col6a1 UTSW 10 76,560,863 (GRCm39) missense probably damaging 1.00
R9060:Col6a1 UTSW 10 76,557,711 (GRCm39) missense probably benign 0.21
R9411:Col6a1 UTSW 10 76,547,487 (GRCm39) missense unknown
RF019:Col6a1 UTSW 10 76,547,449 (GRCm39) missense unknown
X0010:Col6a1 UTSW 10 76,559,372 (GRCm39) missense probably damaging 1.00
X0067:Col6a1 UTSW 10 76,545,809 (GRCm39) missense unknown
Z1088:Col6a1 UTSW 10 76,545,393 (GRCm39) makesense probably null
Predicted Primers PCR Primer
(F):5'- TTGGATTGATGCCCTACCTTGG -3'
(R):5'- ATAGGTGGCCTGAGGAACAC -3'

Sequencing Primer
(F):5'- GATGCCCTACCTTGGATGCC -3'
(R):5'- ACAGAGGCCTACCCATGG -3'
Posted On 2021-11-19