Incidental Mutation 'R8932:Ubb'
ID 690243
Institutional Source Beutler Lab
Gene Symbol Ubb
Ensembl Gene ENSMUSG00000019505
Gene Name ubiquitin B
Synonyms Ubb2
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.350) question?
Stock # R8932 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 62551171-62553213 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 62552153 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 3 (I3N)
Ref Sequence ENSEMBL: ENSMUSP00000019649 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019649] [ENSMUST00000136938]
AlphaFold P0CG49
Predicted Effect probably damaging
Transcript: ENSMUST00000019649
AA Change: I3N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000019649
Gene: ENSMUSG00000019505
AA Change: I3N

DomainStartEndE-ValueType
UBQ 1 72 2.14e-36 SMART
UBQ 77 148 2.14e-36 SMART
UBQ 153 224 2.14e-36 SMART
UBQ 229 300 2.14e-36 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000136938
AA Change: I3N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117361
Gene: ENSMUSG00000019505
AA Change: I3N

DomainStartEndE-ValueType
UBQ 1 72 2.14e-36 SMART
UBQ 77 148 2.14e-36 SMART
UBQ 153 224 2.14e-36 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: This gene encodes ubiquitin, one of the most conserved proteins known. Ubiquitin has a major role in targeting cellular proteins for degradation by the 26S proteosome. It is also involved in the maintenance of chromatin structure, the regulation of gene expression, and the stress response. Ubiquitin is synthesized as a precursor protein consisting of either polyubiquitin chains or a single ubiquitin moiety fused to an unrelated protein. This gene consists of four direct repeats of the ubiquitin coding sequence with no spacer sequence. Consequently, the protein is expressed as a polyubiquitin precursor with a final amino acid after the last repeat. Pseudogenes of this gene are located on chromosomes 3 and 14. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
PHENOTYPE: Targeted disruption of this gene results in progressive degeneration of hypothalamic neurons accompanied by impaired hypothalamic control of energy balance and adult-onset obesity. Both genders are infertile due to a failure of germ cells to progress through meiosis I and hypogonadism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,194,375 Y874C probably damaging Het
Adam34 G T 8: 43,652,155 T151K probably benign Het
Adnp2 C T 18: 80,142,678 G27S probably damaging Het
Ank3 A G 10: 69,824,462 M265V probably benign Het
Apoe T C 7: 19,696,672 D215G possibly damaging Het
Atp5b A G 10: 128,088,981 I438V probably benign Het
Bckdha A G 7: 25,631,011 S387P probably damaging Het
Camkk1 T C 11: 73,033,908 F316L probably damaging Het
Carmil1 A G 13: 24,013,196 Y158H Het
Ccdc148 T C 2: 59,004,042 R29G probably benign Het
Ccdc39 A G 3: 33,830,125 V356A probably benign Het
Cdan1 G A 2: 120,731,087 Q66* probably null Het
Ckap4 A T 10: 84,528,426 S258T probably benign Het
Col5a2 T C 1: 45,380,146 D1258G probably benign Het
Col6a1 G A 10: 76,716,759 P431L unknown Het
Csn1s2a A G 5: 87,785,305 I138V probably benign Het
Cyp19a1 C T 9: 54,176,577 G176D probably benign Het
Dnah10 A G 5: 124,800,951 E2700G possibly damaging Het
Doxl2 G A 6: 48,975,494 E118K probably damaging Het
Eif3l T A 15: 79,075,806 Y23* probably null Het
Fam72a A G 1: 131,528,764 K22E probably benign Het
Golim4 A G 3: 75,898,044 V258A probably benign Het
Gtf2ird2 C T 5: 134,208,898 A272V probably benign Het
Hpse T C 5: 100,699,006 T186A possibly damaging Het
Ift140 A T 17: 25,086,888 Q816H probably benign Het
Iqca A T 1: 90,140,028 I167N probably damaging Het
Iqgap1 A T 7: 80,751,393 F515L probably benign Het
Itgb4 G A 11: 115,988,469 R558H probably benign Het
Kcna10 G A 3: 107,194,103 D17N probably damaging Het
Kcnj16 A G 11: 111,025,003 I164V probably damaging Het
Lrrc55 G T 2: 85,196,271 N136K probably damaging Het
Mdm4 A T 1: 133,012,644 M50K probably benign Het
Mfge8 A G 7: 79,136,782 S290P probably damaging Het
Mindy4 G A 6: 55,224,130 D267N probably benign Het
Mllt10 T A 2: 18,123,806 S199R probably benign Het
Mms22l T C 4: 24,533,029 S436P probably damaging Het
Mpped2 A G 2: 106,867,050 N290S possibly damaging Het
Mrgpra2a A G 7: 47,426,697 L271P probably benign Het
Myrf T A 19: 10,223,567 E247D probably benign Het
Ndrg3 A G 2: 156,940,379 I189T possibly damaging Het
Nenf C T 1: 191,317,951 E48K probably benign Het
Nlgn2 T A 11: 69,828,168 N232Y probably damaging Het
Olfr824 A T 10: 130,126,762 N98K probably benign Het
Oog2 G T 4: 144,194,115 M39I probably benign Het
Osbpl3 A T 6: 50,327,391 N461K probably benign Het
P4ha1 A G 10: 59,339,308 D30G possibly damaging Het
Pappa2 A T 1: 158,763,192 C1631S probably damaging Het
Pigk A G 3: 152,740,234 M161V possibly damaging Het
Prdm1 G T 10: 44,441,339 S496Y probably damaging Het
Prkg2 T C 5: 98,947,440 N624S possibly damaging Het
Rgs6 A G 12: 83,065,959 D181G probably damaging Het
Sbf2 A G 7: 110,440,948 probably null Het
Sbno2 A C 10: 80,062,208 L728W probably damaging Het
Selenbp2 A T 3: 94,702,486 I310F probably damaging Het
Shank3 T A 15: 89,548,783 W1244R possibly damaging Het
Slc17a2 A C 13: 23,820,201 I395L probably benign Het
Slf1 A T 13: 77,046,574 D877E probably damaging Het
Smtn T C 11: 3,522,908 S255G probably benign Het
Tbx2 T A 11: 85,834,707 D161E probably damaging Het
Tex14 C A 11: 87,433,849 L26M possibly damaging Het
Traf7 A G 17: 24,512,312 F249S probably damaging Het
Trpm6 A G 19: 18,838,002 K1151E possibly damaging Het
Ttc7b A G 12: 100,301,763 V773A probably benign Het
Ttn G A 2: 76,772,510 T18456I probably damaging Het
Ttn G C 2: 76,878,827 L8703V unknown Het
Ttn G A 2: 76,917,568 T4379I probably benign Het
Vmn1r209 A T 13: 22,806,173 W116R probably damaging Het
Vmn1r75 A G 7: 11,880,911 D190G probably damaging Het
Wdr12 T A 1: 60,091,043 M70L probably benign Het
Wdr48 C A 9: 119,911,076 T317K probably damaging Het
Zbtb5 A G 4: 44,993,962 V474A probably benign Het
Zfp128 C T 7: 12,891,186 R494C possibly damaging Het
Other mutations in Ubb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03302:Ubb APN 11 62552417 missense probably damaging 1.00
BB009:Ubb UTSW 11 62552785 nonsense probably null
BB019:Ubb UTSW 11 62552785 nonsense probably null
R1120:Ubb UTSW 11 62552183 missense possibly damaging 0.94
R6223:Ubb UTSW 11 62552525 missense possibly damaging 0.91
R6753:Ubb UTSW 11 62551527 splice site probably null
R7932:Ubb UTSW 11 62552785 nonsense probably null
R8201:Ubb UTSW 11 62552227 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGTTCCAAATGCCAGTTTAGTG -3'
(R):5'- ATCTGCATGCCACCTCTCAG -3'

Sequencing Primer
(F):5'- CCAAATGCCAGTTTAGTGTTTTG -3'
(R):5'- ACTCCTTCTGGATGTTGTAATCAGAG -3'
Posted On 2021-11-19