Mutagenetix > Incidental Mutation

Incidental Mutation 'R8932:Ift140'

690260

Institutional Source

Beutler Lab

Gene Symbol

Ift140

Ensembl Gene

ENSMUSG00000024169

Gene Name

intraflagellar transport 140

Synonyms

Tce5, Wdtc2

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R8932 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

25016091-25099495 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 25086888 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Histidine at position 816 (Q816H)

Ref Sequence

ENSEMBL: ENSMUSP00000024983 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024983] [ENSMUST00000137386]

AlphaFold

E9PY46

Predicted Effect

probably benign
Transcript: ENSMUST00000024983
AA Change: Q816H

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000024983
Gene: ENSMUSG00000024169
AA Change: Q816H

Domain	Start	End	E-Value	Type
WD40	55	89	6.14e1	SMART
WD40	91	131	1.49e0	SMART
Blast:WD40	252	304	3e-15	BLAST
WD40	308	352	2.76e0	SMART
Blast:WD40	364	405	8e-17	BLAST
Blast:WD40	510	547	6e-13	BLAST
Blast:WD40	560	603	3e-7	BLAST
Blast:TPR	863	896	9e-13	BLAST
Blast:TPR	1011	1044	1e-13	BLAST
Blast:TPR	1377	1410	8e-13	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000137386
AA Change: Q816H

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000116163
Gene: ENSMUSG00000024169
AA Change: Q816H

Domain	Start	End	E-Value	Type
WD40	55	89	6.14e1	SMART
WD40	91	131	1.49e0	SMART
Blast:WD40	252	304	3e-15	BLAST
WD40	308	352	2.76e0	SMART
Blast:WD40	364	405	1e-16	BLAST
Blast:WD40	510	547	5e-13	BLAST
Blast:WD40	560	603	3e-7	BLAST
Blast:TPR	863	896	8e-13	BLAST
Blast:TPR	1011	1044	9e-14	BLAST

Meta Mutation Damage Score

0.0846

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (67/67)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the subunits of the intraflagellar transport (IFT) complex A. Intraflagellar transport is involved in the genesis, resorption and signaling of primary cilia. The primary cilium is a microtubule-based sensory organelle at the surface of most quiescent mammalian cells, that receives signals from its environment, such as the flow of fluid, light or odors, and transduces those signals to the nucleus. Loss of the corresponding protein in mouse results in renal cystic disease. [provided by RefSeq, Jun 2012]
PHENOTYPE: Mice homozygous for a reporter knock-out allele die at mid-gestation. Mice homozygous for an ENU-induced mutation exhibit cardiovascular defects and situs abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	A	G	15: 8,194,375	Y874C	probably damaging	Het
Adam34	G	T	8: 43,652,155	T151K	probably benign	Het
Adnp2	C	T	18: 80,142,678	G27S	probably damaging	Het
Ank3	A	G	10: 69,824,462	M265V	probably benign	Het
Apoe	T	C	7: 19,696,672	D215G	possibly damaging	Het
Atp5b	A	G	10: 128,088,981	I438V	probably benign	Het
Bckdha	A	G	7: 25,631,011	S387P	probably damaging	Het
Camkk1	T	C	11: 73,033,908	F316L	probably damaging	Het
Carmil1	A	G	13: 24,013,196	Y158H		Het
Ccdc148	T	C	2: 59,004,042	R29G	probably benign	Het
Ccdc39	A	G	3: 33,830,125	V356A	probably benign	Het
Cdan1	G	A	2: 120,731,087	Q66*	probably null	Het
Ckap4	A	T	10: 84,528,426	S258T	probably benign	Het
Col5a2	T	C	1: 45,380,146	D1258G	probably benign	Het
Col6a1	G	A	10: 76,716,759	P431L	unknown	Het
Csn1s2a	A	G	5: 87,785,305	I138V	probably benign	Het
Cyp19a1	C	T	9: 54,176,577	G176D	probably benign	Het
Dnah10	A	G	5: 124,800,951	E2700G	possibly damaging	Het
Doxl2	G	A	6: 48,975,494	E118K	probably damaging	Het
Eif3l	T	A	15: 79,075,806	Y23*	probably null	Het
Fam72a	A	G	1: 131,528,764	K22E	probably benign	Het
Golim4	A	G	3: 75,898,044	V258A	probably benign	Het
Gtf2ird2	C	T	5: 134,208,898	A272V	probably benign	Het
Hpse	T	C	5: 100,699,006	T186A	possibly damaging	Het
Iqca	A	T	1: 90,140,028	I167N	probably damaging	Het
Iqgap1	A	T	7: 80,751,393	F515L	probably benign	Het
Itgb4	G	A	11: 115,988,469	R558H	probably benign	Het
Kcna10	G	A	3: 107,194,103	D17N	probably damaging	Het
Kcnj16	A	G	11: 111,025,003	I164V	probably damaging	Het
Lrrc55	G	T	2: 85,196,271	N136K	probably damaging	Het
Mdm4	A	T	1: 133,012,644	M50K	probably benign	Het
Mfge8	A	G	7: 79,136,782	S290P	probably damaging	Het
Mindy4	G	A	6: 55,224,130	D267N	probably benign	Het
Mllt10	T	A	2: 18,123,806	S199R	probably benign	Het
Mms22l	T	C	4: 24,533,029	S436P	probably damaging	Het
Mpped2	A	G	2: 106,867,050	N290S	possibly damaging	Het
Mrgpra2a	A	G	7: 47,426,697	L271P	probably benign	Het
Myrf	T	A	19: 10,223,567	E247D	probably benign	Het
Ndrg3	A	G	2: 156,940,379	I189T	possibly damaging	Het
Nenf	C	T	1: 191,317,951	E48K	probably benign	Het
Nlgn2	T	A	11: 69,828,168	N232Y	probably damaging	Het
Olfr824	A	T	10: 130,126,762	N98K	probably benign	Het
Oog2	G	T	4: 144,194,115	M39I	probably benign	Het
Osbpl3	A	T	6: 50,327,391	N461K	probably benign	Het
P4ha1	A	G	10: 59,339,308	D30G	possibly damaging	Het
Pappa2	A	T	1: 158,763,192	C1631S	probably damaging	Het
Pigk	A	G	3: 152,740,234	M161V	possibly damaging	Het
Prdm1	G	T	10: 44,441,339	S496Y	probably damaging	Het
Prkg2	T	C	5: 98,947,440	N624S	possibly damaging	Het
Rgs6	A	G	12: 83,065,959	D181G	probably damaging	Het
Sbf2	A	G	7: 110,440,948		probably null	Het
Sbno2	A	C	10: 80,062,208	L728W	probably damaging	Het
Selenbp2	A	T	3: 94,702,486	I310F	probably damaging	Het
Shank3	T	A	15: 89,548,783	W1244R	possibly damaging	Het
Slc17a2	A	C	13: 23,820,201	I395L	probably benign	Het
Slf1	A	T	13: 77,046,574	D877E	probably damaging	Het
Smtn	T	C	11: 3,522,908	S255G	probably benign	Het
Tbx2	T	A	11: 85,834,707	D161E	probably damaging	Het
Tex14	C	A	11: 87,433,849	L26M	possibly damaging	Het
Traf7	A	G	17: 24,512,312	F249S	probably damaging	Het
Trpm6	A	G	19: 18,838,002	K1151E	possibly damaging	Het
Ttc7b	A	G	12: 100,301,763	V773A	probably benign	Het
Ttn	G	A	2: 76,772,510	T18456I	probably damaging	Het
Ttn	G	C	2: 76,878,827	L8703V	unknown	Het
Ttn	G	A	2: 76,917,568	T4379I	probably benign	Het
Ubb	T	A	11: 62,552,153	I3N	probably damaging	Het
Vmn1r209	A	T	13: 22,806,173	W116R	probably damaging	Het
Vmn1r75	A	G	7: 11,880,911	D190G	probably damaging	Het
Wdr12	T	A	1: 60,091,043	M70L	probably benign	Het
Wdr48	C	A	9: 119,911,076	T317K	probably damaging	Het
Zbtb5	A	G	4: 44,993,962	V474A	probably benign	Het
Zfp128	C	T	7: 12,891,186	R494C	possibly damaging	Het

Other mutations in Ift140

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00753:Ift140	APN	17	25055644	missense	probably damaging	1.00
IGL00966:Ift140	APN	17	25018802	missense	probably damaging	1.00
IGL01082:Ift140	APN	17	25048455	missense	possibly damaging	0.89
IGL01394:Ift140	APN	17	25094702	missense	probably benign	0.02
IGL01816:Ift140	APN	17	25087025	splice site	probably null
IGL01994:Ift140	APN	17	25048443	missense	probably damaging	1.00
IGL02102:Ift140	APN	17	25033130	missense	probably benign	0.03
IGL02207:Ift140	APN	17	25055598	missense	probably benign
IGL02493:Ift140	APN	17	25087924	nonsense	probably null
IGL02735:Ift140	APN	17	25034035	splice site	probably benign
IGL02902:Ift140	APN	17	25090762	missense	probably damaging	1.00
IGL03037:Ift140	APN	17	25092394	missense	probably benign	0.02
IGL03122:Ift140	APN	17	25086910	missense	probably damaging	1.00
IGL03206:Ift140	APN	17	25092826	missense	probably damaging	0.98
IGL03271:Ift140	APN	17	25087906	missense	probably damaging	1.00
IGL03358:Ift140	APN	17	25087984	missense	probably damaging	1.00
PIT4515001:Ift140	UTSW	17	25086860	missense	probably damaging	0.98
R0100:Ift140	UTSW	17	25090954	nonsense	probably null
R0100:Ift140	UTSW	17	25090954	nonsense	probably null
R0197:Ift140	UTSW	17	25090933	missense	probably benign	0.09
R0238:Ift140	UTSW	17	25045523	nonsense	probably null
R0238:Ift140	UTSW	17	25045523	nonsense	probably null
R0239:Ift140	UTSW	17	25045523	nonsense	probably null
R0239:Ift140	UTSW	17	25045523	nonsense	probably null
R0355:Ift140	UTSW	17	25048435	nonsense	probably null
R0399:Ift140	UTSW	17	25050340	missense	possibly damaging	0.77
R0574:Ift140	UTSW	17	25051760	splice site	probably null
R0610:Ift140	UTSW	17	25035803	missense	probably benign	0.06
R0701:Ift140	UTSW	17	25090933	missense	probably benign	0.09
R0883:Ift140	UTSW	17	25090933	missense	probably benign	0.09
R0900:Ift140	UTSW	17	25035812	missense	probably benign	0.22
R1167:Ift140	UTSW	17	25035745	missense	probably benign	0.01
R1295:Ift140	UTSW	17	25088933	critical splice donor site	probably null
R1588:Ift140	UTSW	17	25087985	missense	probably damaging	1.00
R1619:Ift140	UTSW	17	25088865	missense	probably damaging	1.00
R1637:Ift140	UTSW	17	25025634	missense	probably benign	0.40
R1854:Ift140	UTSW	17	25035839	missense	probably benign	0.05
R2397:Ift140	UTSW	17	25020736	missense	probably damaging	1.00
R2510:Ift140	UTSW	17	25036308	missense	probably benign	0.02
R2918:Ift140	UTSW	17	25035831	missense	possibly damaging	0.66
R3433:Ift140	UTSW	17	25036308	missense	probably benign	0.02
R3878:Ift140	UTSW	17	25028944	missense	probably benign	0.25
R4559:Ift140	UTSW	17	25090767	missense	probably damaging	0.97
R4670:Ift140	UTSW	17	25098961	unclassified	probably benign
R4711:Ift140	UTSW	17	25094717	splice site	probably null
R4934:Ift140	UTSW	17	25048488	missense	probably benign
R4949:Ift140	UTSW	17	25094665	missense	probably benign	0.06
R4982:Ift140	UTSW	17	25036994	missense	probably damaging	0.99
R5099:Ift140	UTSW	17	25090700	missense	probably damaging	1.00
R5223:Ift140	UTSW	17	25035812	missense	probably benign	0.22
R5268:Ift140	UTSW	17	25020627	missense	possibly damaging	0.48
R5423:Ift140	UTSW	17	25033085	missense	probably damaging	0.96
R5480:Ift140	UTSW	17	25020576	missense	probably damaging	1.00
R5655:Ift140	UTSW	17	25045064	missense	probably damaging	1.00
R5756:Ift140	UTSW	17	25028813	missense	possibly damaging	0.62
R5837:Ift140	UTSW	17	25089540	missense	probably damaging	1.00
R5894:Ift140	UTSW	17	25033919	missense	possibly damaging	0.92
R5907:Ift140	UTSW	17	25092371	missense	probably benign	0.02
R5966:Ift140	UTSW	17	25094761	nonsense	probably null
R6000:Ift140	UTSW	17	25036960	missense	probably benign	0.00
R6046:Ift140	UTSW	17	25055589	missense	probably benign	0.00
R6050:Ift140	UTSW	17	25091005	missense	probably damaging	1.00
R6103:Ift140	UTSW	17	25093126	missense	probably damaging	1.00
R6239:Ift140	UTSW	17	25028972	missense	probably benign	0.26
R6287:Ift140	UTSW	17	25050434	missense	probably benign
R6539:Ift140	UTSW	17	25094669	missense	possibly damaging	0.87
R6656:Ift140	UTSW	17	25032173	missense	probably damaging	0.96
R6723:Ift140	UTSW	17	25033116	missense	probably benign	0.08
R6749:Ift140	UTSW	17	25098916	missense	probably damaging	0.99
R6892:Ift140	UTSW	17	25020546	missense	possibly damaging	0.95
R7151:Ift140	UTSW	17	25055725	missense	probably damaging	1.00
R7235:Ift140	UTSW	17	25020645	missense	possibly damaging	0.88
R7424:Ift140	UTSW	17	25037036	missense	possibly damaging	0.81
R7552:Ift140	UTSW	17	25033115	missense	probably benign	0.02
R7560:Ift140	UTSW	17	25092341	missense	probably benign	0.28
R7660:Ift140	UTSW	17	25051824	missense	probably damaging	1.00
R8105:Ift140	UTSW	17	25036975	missense	probably benign	0.01
R8415:Ift140	UTSW	17	25092915	missense	probably damaging	0.99
R8437:Ift140	UTSW	17	25094677	missense	probably damaging	0.99
R8747:Ift140	UTSW	17	25035835	missense	probably benign
R9226:Ift140	UTSW	17	25098865	missense	probably benign	0.00
R9347:Ift140	UTSW	17	25094779	missense	probably benign	0.00
R9451:Ift140	UTSW	17	25033951	missense	probably benign	0.33
R9456:Ift140	UTSW	17	25035784	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- GGCATGTGGTACCTAGTCTTCAG -3'
(R):5'- GCAATGTGGCAAACCTTCCTC -3'

Sequencing Primer
(F):5'- CCTAGTCTTCAGTCTTACTGTGTAGG -3'
(R):5'- CGGTCCCCTAGTGATGTATGTC -3'

Posted On

2021-11-19