Incidental Mutation 'R8932:Ift140'
ID 690260
Institutional Source Beutler Lab
Gene Symbol Ift140
Ensembl Gene ENSMUSG00000024169
Gene Name intraflagellar transport 140
Synonyms Tce5, Wdtc2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8932 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 25016091-25099495 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 25086888 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Histidine at position 816 (Q816H)
Ref Sequence ENSEMBL: ENSMUSP00000024983 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024983] [ENSMUST00000137386]
AlphaFold E9PY46
Predicted Effect probably benign
Transcript: ENSMUST00000024983
AA Change: Q816H

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000024983
Gene: ENSMUSG00000024169
AA Change: Q816H

DomainStartEndE-ValueType
WD40 55 89 6.14e1 SMART
WD40 91 131 1.49e0 SMART
Blast:WD40 252 304 3e-15 BLAST
WD40 308 352 2.76e0 SMART
Blast:WD40 364 405 8e-17 BLAST
Blast:WD40 510 547 6e-13 BLAST
Blast:WD40 560 603 3e-7 BLAST
Blast:TPR 863 896 9e-13 BLAST
Blast:TPR 1011 1044 1e-13 BLAST
Blast:TPR 1377 1410 8e-13 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000137386
AA Change: Q816H

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000116163
Gene: ENSMUSG00000024169
AA Change: Q816H

DomainStartEndE-ValueType
WD40 55 89 6.14e1 SMART
WD40 91 131 1.49e0 SMART
Blast:WD40 252 304 3e-15 BLAST
WD40 308 352 2.76e0 SMART
Blast:WD40 364 405 1e-16 BLAST
Blast:WD40 510 547 5e-13 BLAST
Blast:WD40 560 603 3e-7 BLAST
Blast:TPR 863 896 8e-13 BLAST
Blast:TPR 1011 1044 9e-14 BLAST
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the subunits of the intraflagellar transport (IFT) complex A. Intraflagellar transport is involved in the genesis, resorption and signaling of primary cilia. The primary cilium is a microtubule-based sensory organelle at the surface of most quiescent mammalian cells, that receives signals from its environment, such as the flow of fluid, light or odors, and transduces those signals to the nucleus. Loss of the corresponding protein in mouse results in renal cystic disease. [provided by RefSeq, Jun 2012]
PHENOTYPE: Mice homozygous for a reporter knock-out allele die at mid-gestation. Mice homozygous for an ENU-induced mutation exhibit cardiovascular defects and situs abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,194,375 Y874C probably damaging Het
Adam34 G T 8: 43,652,155 T151K probably benign Het
Adnp2 C T 18: 80,142,678 G27S probably damaging Het
Ank3 A G 10: 69,824,462 M265V probably benign Het
Apoe T C 7: 19,696,672 D215G possibly damaging Het
Atp5b A G 10: 128,088,981 I438V probably benign Het
Bckdha A G 7: 25,631,011 S387P probably damaging Het
Camkk1 T C 11: 73,033,908 F316L probably damaging Het
Carmil1 A G 13: 24,013,196 Y158H Het
Ccdc148 T C 2: 59,004,042 R29G probably benign Het
Ccdc39 A G 3: 33,830,125 V356A probably benign Het
Cdan1 G A 2: 120,731,087 Q66* probably null Het
Ckap4 A T 10: 84,528,426 S258T probably benign Het
Col5a2 T C 1: 45,380,146 D1258G probably benign Het
Col6a1 G A 10: 76,716,759 P431L unknown Het
Csn1s2a A G 5: 87,785,305 I138V probably benign Het
Cyp19a1 C T 9: 54,176,577 G176D probably benign Het
Dnah10 A G 5: 124,800,951 E2700G possibly damaging Het
Doxl2 G A 6: 48,975,494 E118K probably damaging Het
Eif3l T A 15: 79,075,806 Y23* probably null Het
Fam72a A G 1: 131,528,764 K22E probably benign Het
Golim4 A G 3: 75,898,044 V258A probably benign Het
Gtf2ird2 C T 5: 134,208,898 A272V probably benign Het
Hpse T C 5: 100,699,006 T186A possibly damaging Het
Iqca A T 1: 90,140,028 I167N probably damaging Het
Iqgap1 A T 7: 80,751,393 F515L probably benign Het
Itgb4 G A 11: 115,988,469 R558H probably benign Het
Kcna10 G A 3: 107,194,103 D17N probably damaging Het
Kcnj16 A G 11: 111,025,003 I164V probably damaging Het
Lrrc55 G T 2: 85,196,271 N136K probably damaging Het
Mdm4 A T 1: 133,012,644 M50K probably benign Het
Mfge8 A G 7: 79,136,782 S290P probably damaging Het
Mindy4 G A 6: 55,224,130 D267N probably benign Het
Mllt10 T A 2: 18,123,806 S199R probably benign Het
Mms22l T C 4: 24,533,029 S436P probably damaging Het
Mpped2 A G 2: 106,867,050 N290S possibly damaging Het
Mrgpra2a A G 7: 47,426,697 L271P probably benign Het
Myrf T A 19: 10,223,567 E247D probably benign Het
Ndrg3 A G 2: 156,940,379 I189T possibly damaging Het
Nenf C T 1: 191,317,951 E48K probably benign Het
Nlgn2 T A 11: 69,828,168 N232Y probably damaging Het
Olfr824 A T 10: 130,126,762 N98K probably benign Het
Oog2 G T 4: 144,194,115 M39I probably benign Het
Osbpl3 A T 6: 50,327,391 N461K probably benign Het
P4ha1 A G 10: 59,339,308 D30G possibly damaging Het
Pappa2 A T 1: 158,763,192 C1631S probably damaging Het
Pigk A G 3: 152,740,234 M161V possibly damaging Het
Prdm1 G T 10: 44,441,339 S496Y probably damaging Het
Prkg2 T C 5: 98,947,440 N624S possibly damaging Het
Rgs6 A G 12: 83,065,959 D181G probably damaging Het
Sbf2 A G 7: 110,440,948 probably null Het
Sbno2 A C 10: 80,062,208 L728W probably damaging Het
Selenbp2 A T 3: 94,702,486 I310F probably damaging Het
Shank3 T A 15: 89,548,783 W1244R possibly damaging Het
Slc17a2 A C 13: 23,820,201 I395L probably benign Het
Slf1 A T 13: 77,046,574 D877E probably damaging Het
Smtn T C 11: 3,522,908 S255G probably benign Het
Tbx2 T A 11: 85,834,707 D161E probably damaging Het
Tex14 C A 11: 87,433,849 L26M possibly damaging Het
Traf7 A G 17: 24,512,312 F249S probably damaging Het
Trpm6 A G 19: 18,838,002 K1151E possibly damaging Het
Ttc7b A G 12: 100,301,763 V773A probably benign Het
Ttn G A 2: 76,772,510 T18456I probably damaging Het
Ttn G C 2: 76,878,827 L8703V unknown Het
Ttn G A 2: 76,917,568 T4379I probably benign Het
Ubb T A 11: 62,552,153 I3N probably damaging Het
Vmn1r209 A T 13: 22,806,173 W116R probably damaging Het
Vmn1r75 A G 7: 11,880,911 D190G probably damaging Het
Wdr12 T A 1: 60,091,043 M70L probably benign Het
Wdr48 C A 9: 119,911,076 T317K probably damaging Het
Zbtb5 A G 4: 44,993,962 V474A probably benign Het
Zfp128 C T 7: 12,891,186 R494C possibly damaging Het
Other mutations in Ift140
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00753:Ift140 APN 17 25055644 missense probably damaging 1.00
IGL00966:Ift140 APN 17 25018802 missense probably damaging 1.00
IGL01082:Ift140 APN 17 25048455 missense possibly damaging 0.89
IGL01394:Ift140 APN 17 25094702 missense probably benign 0.02
IGL01816:Ift140 APN 17 25087025 splice site probably null
IGL01994:Ift140 APN 17 25048443 missense probably damaging 1.00
IGL02102:Ift140 APN 17 25033130 missense probably benign 0.03
IGL02207:Ift140 APN 17 25055598 missense probably benign
IGL02493:Ift140 APN 17 25087924 nonsense probably null
IGL02735:Ift140 APN 17 25034035 splice site probably benign
IGL02902:Ift140 APN 17 25090762 missense probably damaging 1.00
IGL03037:Ift140 APN 17 25092394 missense probably benign 0.02
IGL03122:Ift140 APN 17 25086910 missense probably damaging 1.00
IGL03206:Ift140 APN 17 25092826 missense probably damaging 0.98
IGL03271:Ift140 APN 17 25087906 missense probably damaging 1.00
IGL03358:Ift140 APN 17 25087984 missense probably damaging 1.00
PIT4515001:Ift140 UTSW 17 25086860 missense probably damaging 0.98
R0100:Ift140 UTSW 17 25090954 nonsense probably null
R0100:Ift140 UTSW 17 25090954 nonsense probably null
R0197:Ift140 UTSW 17 25090933 missense probably benign 0.09
R0238:Ift140 UTSW 17 25045523 nonsense probably null
R0238:Ift140 UTSW 17 25045523 nonsense probably null
R0239:Ift140 UTSW 17 25045523 nonsense probably null
R0239:Ift140 UTSW 17 25045523 nonsense probably null
R0355:Ift140 UTSW 17 25048435 nonsense probably null
R0399:Ift140 UTSW 17 25050340 missense possibly damaging 0.77
R0574:Ift140 UTSW 17 25051760 splice site probably null
R0610:Ift140 UTSW 17 25035803 missense probably benign 0.06
R0701:Ift140 UTSW 17 25090933 missense probably benign 0.09
R0883:Ift140 UTSW 17 25090933 missense probably benign 0.09
R0900:Ift140 UTSW 17 25035812 missense probably benign 0.22
R1167:Ift140 UTSW 17 25035745 missense probably benign 0.01
R1295:Ift140 UTSW 17 25088933 critical splice donor site probably null
R1588:Ift140 UTSW 17 25087985 missense probably damaging 1.00
R1619:Ift140 UTSW 17 25088865 missense probably damaging 1.00
R1637:Ift140 UTSW 17 25025634 missense probably benign 0.40
R1854:Ift140 UTSW 17 25035839 missense probably benign 0.05
R2397:Ift140 UTSW 17 25020736 missense probably damaging 1.00
R2510:Ift140 UTSW 17 25036308 missense probably benign 0.02
R2918:Ift140 UTSW 17 25035831 missense possibly damaging 0.66
R3433:Ift140 UTSW 17 25036308 missense probably benign 0.02
R3878:Ift140 UTSW 17 25028944 missense probably benign 0.25
R4559:Ift140 UTSW 17 25090767 missense probably damaging 0.97
R4670:Ift140 UTSW 17 25098961 unclassified probably benign
R4711:Ift140 UTSW 17 25094717 splice site probably null
R4934:Ift140 UTSW 17 25048488 missense probably benign
R4949:Ift140 UTSW 17 25094665 missense probably benign 0.06
R4982:Ift140 UTSW 17 25036994 missense probably damaging 0.99
R5099:Ift140 UTSW 17 25090700 missense probably damaging 1.00
R5223:Ift140 UTSW 17 25035812 missense probably benign 0.22
R5268:Ift140 UTSW 17 25020627 missense possibly damaging 0.48
R5423:Ift140 UTSW 17 25033085 missense probably damaging 0.96
R5480:Ift140 UTSW 17 25020576 missense probably damaging 1.00
R5655:Ift140 UTSW 17 25045064 missense probably damaging 1.00
R5756:Ift140 UTSW 17 25028813 missense possibly damaging 0.62
R5837:Ift140 UTSW 17 25089540 missense probably damaging 1.00
R5894:Ift140 UTSW 17 25033919 missense possibly damaging 0.92
R5907:Ift140 UTSW 17 25092371 missense probably benign 0.02
R5966:Ift140 UTSW 17 25094761 nonsense probably null
R6000:Ift140 UTSW 17 25036960 missense probably benign 0.00
R6046:Ift140 UTSW 17 25055589 missense probably benign 0.00
R6050:Ift140 UTSW 17 25091005 missense probably damaging 1.00
R6103:Ift140 UTSW 17 25093126 missense probably damaging 1.00
R6239:Ift140 UTSW 17 25028972 missense probably benign 0.26
R6287:Ift140 UTSW 17 25050434 missense probably benign
R6539:Ift140 UTSW 17 25094669 missense possibly damaging 0.87
R6656:Ift140 UTSW 17 25032173 missense probably damaging 0.96
R6723:Ift140 UTSW 17 25033116 missense probably benign 0.08
R6749:Ift140 UTSW 17 25098916 missense probably damaging 0.99
R6892:Ift140 UTSW 17 25020546 missense possibly damaging 0.95
R7151:Ift140 UTSW 17 25055725 missense probably damaging 1.00
R7235:Ift140 UTSW 17 25020645 missense possibly damaging 0.88
R7424:Ift140 UTSW 17 25037036 missense possibly damaging 0.81
R7552:Ift140 UTSW 17 25033115 missense probably benign 0.02
R7560:Ift140 UTSW 17 25092341 missense probably benign 0.28
R7660:Ift140 UTSW 17 25051824 missense probably damaging 1.00
R8105:Ift140 UTSW 17 25036975 missense probably benign 0.01
R8415:Ift140 UTSW 17 25092915 missense probably damaging 0.99
R8437:Ift140 UTSW 17 25094677 missense probably damaging 0.99
R8747:Ift140 UTSW 17 25035835 missense probably benign
R9226:Ift140 UTSW 17 25098865 missense probably benign 0.00
R9347:Ift140 UTSW 17 25094779 missense probably benign 0.00
R9451:Ift140 UTSW 17 25033951 missense probably benign 0.33
R9456:Ift140 UTSW 17 25035784 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GGCATGTGGTACCTAGTCTTCAG -3'
(R):5'- GCAATGTGGCAAACCTTCCTC -3'

Sequencing Primer
(F):5'- CCTAGTCTTCAGTCTTACTGTGTAGG -3'
(R):5'- CGGTCCCCTAGTGATGTATGTC -3'
Posted On 2021-11-19