Incidental Mutation 'R8932:Trpm6'
ID 690263
Institutional Source Beutler Lab
Gene Symbol Trpm6
Ensembl Gene ENSMUSG00000024727
Gene Name transient receptor potential cation channel, subfamily M, member 6
Synonyms CHAK2
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8932 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 18749983-18892510 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 18838002 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 1151 (K1151E)
Ref Sequence ENSEMBL: ENSMUSP00000037443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040489]
AlphaFold Q8CIR4
Predicted Effect possibly damaging
Transcript: ENSMUST00000040489
AA Change: K1151E

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000037443
Gene: ENSMUSG00000024727
AA Change: K1151E

DomainStartEndE-ValueType
Blast:ANK 430 459 4e-8 BLAST
low complexity region 580 604 N/A INTRINSIC
transmembrane domain 749 766 N/A INTRINSIC
Pfam:Ion_trans 847 1087 2.8e-13 PFAM
low complexity region 1113 1126 N/A INTRINSIC
low complexity region 1136 1154 N/A INTRINSIC
Pfam:TRPM_tetra 1176 1231 7.5e-27 PFAM
low complexity region 1320 1331 N/A INTRINSIC
low complexity region 1578 1596 N/A INTRINSIC
Blast:Alpha_kinase 1618 1673 9e-11 BLAST
low complexity region 1682 1695 N/A INTRINSIC
Alpha_kinase 1761 1978 1e-84 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is predominantly expressed in the kidney and colon, and encodes a protein containing an ion channel domain and a protein kinase domain. It is crucial for magnesium homeostasis, and plays an essential role in epithelial magnesium transport and in the active magnesium absorption in the gut and kidney. Mutations in this gene are associated with hypomagnesemia with secondary hypocalcemia. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic and postnatal lethality with exencephaly, spina bifida occulta, and abnormal brain and facial development. Mice heterozygous for a knock-out allele exhibit some premature death and decreased serummagnesium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,194,375 Y874C probably damaging Het
Adam34 G T 8: 43,652,155 T151K probably benign Het
Adnp2 C T 18: 80,142,678 G27S probably damaging Het
Ank3 A G 10: 69,824,462 M265V probably benign Het
Apoe T C 7: 19,696,672 D215G possibly damaging Het
Atp5b A G 10: 128,088,981 I438V probably benign Het
Bckdha A G 7: 25,631,011 S387P probably damaging Het
Camkk1 T C 11: 73,033,908 F316L probably damaging Het
Carmil1 A G 13: 24,013,196 Y158H Het
Ccdc148 T C 2: 59,004,042 R29G probably benign Het
Ccdc39 A G 3: 33,830,125 V356A probably benign Het
Cdan1 G A 2: 120,731,087 Q66* probably null Het
Ckap4 A T 10: 84,528,426 S258T probably benign Het
Col5a2 T C 1: 45,380,146 D1258G probably benign Het
Col6a1 G A 10: 76,716,759 P431L unknown Het
Csn1s2a A G 5: 87,785,305 I138V probably benign Het
Cyp19a1 C T 9: 54,176,577 G176D probably benign Het
Dnah10 A G 5: 124,800,951 E2700G possibly damaging Het
Doxl2 G A 6: 48,975,494 E118K probably damaging Het
Eif3l T A 15: 79,075,806 Y23* probably null Het
Fam72a A G 1: 131,528,764 K22E probably benign Het
Golim4 A G 3: 75,898,044 V258A probably benign Het
Gtf2ird2 C T 5: 134,208,898 A272V probably benign Het
Hpse T C 5: 100,699,006 T186A possibly damaging Het
Ift140 A T 17: 25,086,888 Q816H probably benign Het
Iqca A T 1: 90,140,028 I167N probably damaging Het
Iqgap1 A T 7: 80,751,393 F515L probably benign Het
Itgb4 G A 11: 115,988,469 R558H probably benign Het
Kcna10 G A 3: 107,194,103 D17N probably damaging Het
Kcnj16 A G 11: 111,025,003 I164V probably damaging Het
Lrrc55 G T 2: 85,196,271 N136K probably damaging Het
Mdm4 A T 1: 133,012,644 M50K probably benign Het
Mfge8 A G 7: 79,136,782 S290P probably damaging Het
Mindy4 G A 6: 55,224,130 D267N probably benign Het
Mllt10 T A 2: 18,123,806 S199R probably benign Het
Mms22l T C 4: 24,533,029 S436P probably damaging Het
Mpped2 A G 2: 106,867,050 N290S possibly damaging Het
Mrgpra2a A G 7: 47,426,697 L271P probably benign Het
Myrf T A 19: 10,223,567 E247D probably benign Het
Ndrg3 A G 2: 156,940,379 I189T possibly damaging Het
Nenf C T 1: 191,317,951 E48K probably benign Het
Nlgn2 T A 11: 69,828,168 N232Y probably damaging Het
Olfr824 A T 10: 130,126,762 N98K probably benign Het
Oog2 G T 4: 144,194,115 M39I probably benign Het
Osbpl3 A T 6: 50,327,391 N461K probably benign Het
P4ha1 A G 10: 59,339,308 D30G possibly damaging Het
Pappa2 A T 1: 158,763,192 C1631S probably damaging Het
Pigk A G 3: 152,740,234 M161V possibly damaging Het
Prdm1 G T 10: 44,441,339 S496Y probably damaging Het
Prkg2 T C 5: 98,947,440 N624S possibly damaging Het
Rgs6 A G 12: 83,065,959 D181G probably damaging Het
Sbf2 A G 7: 110,440,948 probably null Het
Sbno2 A C 10: 80,062,208 L728W probably damaging Het
Selenbp2 A T 3: 94,702,486 I310F probably damaging Het
Shank3 T A 15: 89,548,783 W1244R possibly damaging Het
Slc17a2 A C 13: 23,820,201 I395L probably benign Het
Slf1 A T 13: 77,046,574 D877E probably damaging Het
Smtn T C 11: 3,522,908 S255G probably benign Het
Tbx2 T A 11: 85,834,707 D161E probably damaging Het
Tex14 C A 11: 87,433,849 L26M possibly damaging Het
Traf7 A G 17: 24,512,312 F249S probably damaging Het
Ttc7b A G 12: 100,301,763 V773A probably benign Het
Ttn G A 2: 76,772,510 T18456I probably damaging Het
Ttn G C 2: 76,878,827 L8703V unknown Het
Ttn G A 2: 76,917,568 T4379I probably benign Het
Ubb T A 11: 62,552,153 I3N probably damaging Het
Vmn1r209 A T 13: 22,806,173 W116R probably damaging Het
Vmn1r75 A G 7: 11,880,911 D190G probably damaging Het
Wdr12 T A 1: 60,091,043 M70L probably benign Het
Wdr48 C A 9: 119,911,076 T317K probably damaging Het
Zbtb5 A G 4: 44,993,962 V474A probably benign Het
Zfp128 C T 7: 12,891,186 R494C possibly damaging Het
Other mutations in Trpm6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:Trpm6 APN 19 18783908 splice site probably benign
IGL00862:Trpm6 APN 19 18827528 missense probably damaging 1.00
IGL01348:Trpm6 APN 19 18877651 missense probably damaging 1.00
IGL01400:Trpm6 APN 19 18825794 nonsense probably null
IGL01451:Trpm6 APN 19 18809569 missense probably damaging 1.00
IGL01508:Trpm6 APN 19 18796530 nonsense probably null
IGL01995:Trpm6 APN 19 18830327 splice site probably benign
IGL02092:Trpm6 APN 19 18772331 missense possibly damaging 0.59
IGL02152:Trpm6 APN 19 18832539 missense possibly damaging 0.93
IGL02294:Trpm6 APN 19 18854063 missense probably benign
IGL02329:Trpm6 APN 19 18854217 missense probably benign 0.17
IGL02366:Trpm6 APN 19 18778510 splice site probably benign
IGL02402:Trpm6 APN 19 18786756 missense probably benign 0.18
IGL02457:Trpm6 APN 19 18825791 missense probably damaging 1.00
IGL02457:Trpm6 APN 19 18827398 nonsense probably null
IGL02684:Trpm6 APN 19 18802207 splice site probably benign
IGL02705:Trpm6 APN 19 18776733 critical splice donor site probably null
IGL02728:Trpm6 APN 19 18809652 missense possibly damaging 0.71
IGL02742:Trpm6 APN 19 18830012 splice site probably benign
IGL02818:Trpm6 APN 19 18866257 missense probably benign 0.04
IGL02836:Trpm6 APN 19 18813482 missense probably damaging 1.00
IGL03119:Trpm6 APN 19 18838017 nonsense probably null
IGL03193:Trpm6 APN 19 18825872 missense possibly damaging 0.94
IGL03227:Trpm6 APN 19 18819119 missense probably benign 0.01
IGL03227:Trpm6 APN 19 18786779 missense probably benign 0.12
IGL03231:Trpm6 APN 19 18819181 missense probably benign
IGL03245:Trpm6 APN 19 18877701 missense probably damaging 1.00
IGL03328:Trpm6 APN 19 18838082 missense possibly damaging 0.94
IGL03341:Trpm6 APN 19 18813486 missense probably benign
P0043:Trpm6 UTSW 19 18877765 missense probably damaging 1.00
PIT4260001:Trpm6 UTSW 19 18825802 missense possibly damaging 0.48
R0057:Trpm6 UTSW 19 18786755 missense probably benign 0.05
R0115:Trpm6 UTSW 19 18829952 missense probably damaging 0.98
R0119:Trpm6 UTSW 19 18832593 missense probably benign 0.05
R0140:Trpm6 UTSW 19 18819194 splice site probably null
R0267:Trpm6 UTSW 19 18823378 missense probably benign
R0350:Trpm6 UTSW 19 18883957 splice site probably null
R0373:Trpm6 UTSW 19 18853587 missense probably benign 0.15
R0393:Trpm6 UTSW 19 18778644 missense probably damaging 0.99
R0416:Trpm6 UTSW 19 18783025 splice site probably benign
R0505:Trpm6 UTSW 19 18873902 splice site probably benign
R0526:Trpm6 UTSW 19 18792876 missense probably damaging 0.97
R0607:Trpm6 UTSW 19 18872221 missense probably benign 0.00
R0609:Trpm6 UTSW 19 18825862 missense probably damaging 0.97
R0714:Trpm6 UTSW 19 18838087 missense possibly damaging 0.90
R1215:Trpm6 UTSW 19 18796498 missense probably damaging 1.00
R1474:Trpm6 UTSW 19 18796495 missense probably benign 0.28
R1512:Trpm6 UTSW 19 18875931 missense probably benign
R1558:Trpm6 UTSW 19 18786828 missense probably benign 0.04
R1597:Trpm6 UTSW 19 18827524 missense probably damaging 0.98
R1618:Trpm6 UTSW 19 18877631 missense possibly damaging 0.88
R1779:Trpm6 UTSW 19 18856217 missense probably damaging 1.00
R1796:Trpm6 UTSW 19 18827567 missense possibly damaging 0.90
R1799:Trpm6 UTSW 19 18891999 splice site probably null
R1840:Trpm6 UTSW 19 18866267 missense probably benign 0.21
R1991:Trpm6 UTSW 19 18796284 missense probably benign 0.00
R2030:Trpm6 UTSW 19 18854265 missense probably benign
R2073:Trpm6 UTSW 19 18876042 missense probably damaging 1.00
R2074:Trpm6 UTSW 19 18877739 missense probably damaging 1.00
R2096:Trpm6 UTSW 19 18825752 missense probably damaging 0.97
R2103:Trpm6 UTSW 19 18796284 missense probably benign 0.00
R2106:Trpm6 UTSW 19 18813350 missense possibly damaging 0.95
R2117:Trpm6 UTSW 19 18829952 missense probably damaging 0.98
R2850:Trpm6 UTSW 19 18792090 missense possibly damaging 0.68
R3125:Trpm6 UTSW 19 18854431 missense probably benign 0.05
R3719:Trpm6 UTSW 19 18772393 nonsense probably null
R3779:Trpm6 UTSW 19 18876039 missense possibly damaging 0.80
R4115:Trpm6 UTSW 19 18832557 missense probably damaging 1.00
R4367:Trpm6 UTSW 19 18827525 missense probably damaging 0.99
R4523:Trpm6 UTSW 19 18796500 missense probably damaging 1.00
R4546:Trpm6 UTSW 19 18832477 missense probably damaging 1.00
R4564:Trpm6 UTSW 19 18832597 missense possibly damaging 0.95
R4565:Trpm6 UTSW 19 18825872 missense probably damaging 1.00
R4697:Trpm6 UTSW 19 18853791 missense probably benign 0.01
R4714:Trpm6 UTSW 19 18854200 missense possibly damaging 0.93
R4750:Trpm6 UTSW 19 18876064 missense probably damaging 0.99
R4771:Trpm6 UTSW 19 18813493 missense probably damaging 0.97
R4791:Trpm6 UTSW 19 18867981 missense probably benign 0.00
R4814:Trpm6 UTSW 19 18862212 missense probably benign 0.11
R5028:Trpm6 UTSW 19 18786760 missense probably damaging 1.00
R5237:Trpm6 UTSW 19 18813464 missense probably damaging 1.00
R5615:Trpm6 UTSW 19 18829933 missense probably damaging 0.96
R5642:Trpm6 UTSW 19 18830207 missense probably damaging 1.00
R5645:Trpm6 UTSW 19 18853604 missense probably damaging 1.00
R5726:Trpm6 UTSW 19 18853617 missense probably damaging 1.00
R5832:Trpm6 UTSW 19 18786819 missense possibly damaging 0.66
R5843:Trpm6 UTSW 19 18856175 missense probably benign 0.04
R5955:Trpm6 UTSW 19 18892019 missense possibly damaging 0.75
R6101:Trpm6 UTSW 19 18853748 nonsense probably null
R6105:Trpm6 UTSW 19 18853748 nonsense probably null
R6211:Trpm6 UTSW 19 18783128 missense probably damaging 1.00
R6228:Trpm6 UTSW 19 18854291 missense probably damaging 1.00
R6263:Trpm6 UTSW 19 18854108 missense possibly damaging 0.94
R6453:Trpm6 UTSW 19 18829990 missense probably damaging 1.00
R6562:Trpm6 UTSW 19 18838042 missense probably damaging 1.00
R6624:Trpm6 UTSW 19 18796439 critical splice acceptor site probably null
R6624:Trpm6 UTSW 19 18889020 missense probably damaging 1.00
R6729:Trpm6 UTSW 19 18830297 missense probably damaging 1.00
R6765:Trpm6 UTSW 19 18877765 missense probably damaging 1.00
R6976:Trpm6 UTSW 19 18783163 missense probably benign
R7103:Trpm6 UTSW 19 18813547 missense possibly damaging 0.87
R7126:Trpm6 UTSW 19 18854033 nonsense probably null
R7128:Trpm6 UTSW 19 18811773 missense possibly damaging 0.92
R7157:Trpm6 UTSW 19 18838098 missense possibly damaging 0.91
R7212:Trpm6 UTSW 19 18853791 missense probably benign 0.01
R7263:Trpm6 UTSW 19 18876786 missense probably damaging 1.00
R7268:Trpm6 UTSW 19 18778585 missense probably benign 0.13
R7305:Trpm6 UTSW 19 18876091 missense probably benign 0.30
R7498:Trpm6 UTSW 19 18876120 missense probably damaging 1.00
R7558:Trpm6 UTSW 19 18778665 missense probably damaging 0.96
R7590:Trpm6 UTSW 19 18832581 missense probably benign 0.31
R7646:Trpm6 UTSW 19 18867961 missense probably benign 0.10
R7650:Trpm6 UTSW 19 18876013 missense possibly damaging 0.70
R7727:Trpm6 UTSW 19 18854249 missense probably damaging 0.97
R7743:Trpm6 UTSW 19 18827408 missense probably benign 0.03
R7747:Trpm6 UTSW 19 18750045 splice site probably null
R7807:Trpm6 UTSW 19 18829856 missense probably benign 0.11
R7870:Trpm6 UTSW 19 18815241 missense probably benign 0.01
R7891:Trpm6 UTSW 19 18776710 missense probably benign 0.01
R7955:Trpm6 UTSW 19 18854290 missense probably benign 0.01
R7965:Trpm6 UTSW 19 18876110 missense probably damaging 1.00
R7967:Trpm6 UTSW 19 18778659 missense probably damaging 0.99
R7992:Trpm6 UTSW 19 18815350 missense probably damaging 1.00
R8035:Trpm6 UTSW 19 18792862 missense probably damaging 0.97
R8108:Trpm6 UTSW 19 18811790 missense probably damaging 1.00
R8268:Trpm6 UTSW 19 18873861 missense possibly damaging 0.85
R8411:Trpm6 UTSW 19 18853968 missense probably benign 0.39
R8413:Trpm6 UTSW 19 18832485 missense probably benign 0.00
R8534:Trpm6 UTSW 19 18892095 missense probably benign 0.00
R8990:Trpm6 UTSW 19 18815435 missense probably damaging 1.00
R9403:Trpm6 UTSW 19 18832652 missense possibly damaging 0.84
R9446:Trpm6 UTSW 19 18838098 missense possibly damaging 0.91
R9463:Trpm6 UTSW 19 18783900 critical splice donor site probably null
R9485:Trpm6 UTSW 19 18778614 missense probably benign 0.06
R9536:Trpm6 UTSW 19 18786759 missense probably damaging 1.00
R9549:Trpm6 UTSW 19 18876030 nonsense probably null
R9564:Trpm6 UTSW 19 18873876 missense possibly damaging 0.92
R9626:Trpm6 UTSW 19 18813482 missense probably damaging 1.00
R9655:Trpm6 UTSW 19 18892102 missense probably benign
R9721:Trpm6 UTSW 19 18829972 missense probably benign 0.12
R9742:Trpm6 UTSW 19 18823402 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- ATGTGACCATTTCATCAATCCAACC -3'
(R):5'- AGCAGAACTCAAACCTATGGGG -3'

Sequencing Primer
(F):5'- TTTCATCAATCCAACCACCCCAAG -3'
(R):5'- CCTATGGGGTTTGAAAGTAGGTC -3'
Posted On 2021-11-19