Incidental Mutation 'R8998:Psme4'
ID 690293
Institutional Source Beutler Lab
Gene Symbol Psme4
Ensembl Gene ENSMUSG00000040850
Gene Name proteasome (prosome, macropain) activator subunit 4
Synonyms
Accession Numbers

Genbank: NM_134013

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8998 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 30771726-30880361 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 30838957 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Phenylalanine at position 1120 (L1120F)
Ref Sequence ENSEMBL: ENSMUSP00000045460 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041231]
AlphaFold Q5SSW2
Predicted Effect possibly damaging
Transcript: ENSMUST00000041231
AA Change: L1120F

PolyPhen 2 Score 0.783 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000045460
Gene: ENSMUSG00000040850
AA Change: L1120F

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
low complexity region 122 133 N/A INTRINSIC
Pfam:BLM10_mid 330 828 8.8e-119 PFAM
SCOP:d1b3ua_ 1183 1716 3e-14 SMART
Pfam:DUF3437 1756 1843 5.3e-39 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (41/41)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele show normal repair of DNA double-strand breaks but exhibit significantly reduced male fertility due to defects in spermatogenesis observed in both meiotic spermatocytes and postmeiotic haploid spermatids. [provided by MGI curators]
Allele List at MGI

All alleles(25) : Targeted, knock-out(1) Gene trapped(24)

Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aloxe3 A G 11: 69,142,225 K575R probably benign Het
Atp10b T A 11: 43,259,899 *1475R probably null Het
Baz2b T C 2: 59,969,264 D237G probably benign Het
Cacna2d4 A C 6: 119,242,915 Q215H possibly damaging Het
Capn15 G A 17: 25,963,081 R651C probably damaging Het
Ccdc28b A G 4: 129,622,678 V29A probably benign Het
Cyb5rl A G 4: 107,080,960 T170A possibly damaging Het
D330020A13Rik A G 6: 120,294,929 T189A unknown Het
Emsy C A 7: 98,619,305 V524F possibly damaging Het
Eppk1 T A 15: 76,102,736 N3315I probably damaging Het
Erich2 T G 2: 70,531,620 probably benign Het
Fkbp15 T C 4: 62,324,128 D529G probably damaging Het
Gbx2 C A 1: 89,929,023 G215V possibly damaging Het
Gzmd T A 14: 56,130,687 Y105F possibly damaging Het
Hpse G A 5: 100,692,243 T336M probably damaging Het
Hrg A G 16: 22,953,705 D88G probably damaging Het
Kif20b G A 19: 34,936,853 probably benign Het
Kmt2a A G 9: 44,821,877 M2381T unknown Het
Krtap5-3 T A 7: 142,202,196 C257S unknown Het
Met C T 6: 17,491,535 R99W probably benign Het
Nlrp4b A G 7: 10,715,702 R611G probably null Het
Olfr1154 T A 2: 87,902,845 Y277F probably damaging Het
Olfr32 C T 2: 90,139,128 V4I probably benign Het
Olfr516 A C 7: 108,845,810 S67A probably benign Het
Olfr905 T C 9: 38,473,491 V248A probably benign Het
Papd5 A G 8: 88,250,722 H384R probably benign Het
Pclo A G 5: 14,677,496 I2123V unknown Het
Phf10 G C 17: 14,950,621 A350G probably benign Het
Pira2 T C 7: 3,842,491 Y298C probably damaging Het
Pkhd1 A T 1: 20,364,201 Y2338N probably damaging Het
Safb2 A T 17: 56,563,391 H934Q possibly damaging Het
Slc4a7 T A 14: 14,775,346 L884Q probably damaging Het
Smc4 A C 3: 69,027,561 probably benign Het
Spag16 T C 1: 69,896,547 V311A probably benign Het
Spert T C 14: 75,583,214 E357G probably damaging Het
Sprr2j-ps T C 3: 92,418,869 V17A unknown Het
Tenm3 T C 8: 48,276,687 Y1428C probably damaging Het
Treml2 A G 17: 48,302,747 D69G possibly damaging Het
Ttn T C 2: 76,827,933 K12368E unknown Het
Usp17le T C 7: 104,768,762 D391G probably benign Het
Usp28 G A 9: 49,037,839 R911Q probably benign Het
Wdfy3 A C 5: 101,845,192 S3274R probably benign Het
Ythdc2 T C 18: 44,864,304 V976A probably benign Het
Zfp334 A G 2: 165,381,488 S212P possibly damaging Het
Other mutations in Psme4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Psme4 APN 11 30815710 critical splice donor site probably null
IGL00401:Psme4 APN 11 30821079 splice site probably benign
IGL00475:Psme4 APN 11 30845252 missense probably benign 0.14
IGL00576:Psme4 APN 11 30823145 missense possibly damaging 0.50
IGL00817:Psme4 APN 11 30820129 missense probably benign 0.01
IGL01525:Psme4 APN 11 30809936 splice site probably benign
IGL01862:Psme4 APN 11 30812038 nonsense probably null
IGL02310:Psme4 APN 11 30837484 missense probably benign 0.06
IGL02477:Psme4 APN 11 30842083 missense probably damaging 0.99
IGL02545:Psme4 APN 11 30841586 missense possibly damaging 0.81
IGL02608:Psme4 APN 11 30820944 missense probably benign 0.34
IGL02621:Psme4 APN 11 30848131 missense probably benign
IGL02822:Psme4 APN 11 30848204 unclassified probably benign
IGL02833:Psme4 APN 11 30850715 unclassified probably benign
IGL02964:Psme4 APN 11 30791095 nonsense probably null
IGL03273:Psme4 APN 11 30848130 missense probably damaging 1.00
IGL03348:Psme4 APN 11 30876796 missense probably damaging 1.00
IGL03382:Psme4 APN 11 30807788 missense possibly damaging 0.94
H2330:Psme4 UTSW 11 30851210 missense probably benign 0.17
PIT4378001:Psme4 UTSW 11 30821079 splice site probably benign
R0276:Psme4 UTSW 11 30811980 missense probably damaging 1.00
R0462:Psme4 UTSW 11 30848117 missense probably damaging 1.00
R0685:Psme4 UTSW 11 30878415 missense probably damaging 1.00
R0766:Psme4 UTSW 11 30807687 splice site probably null
R0830:Psme4 UTSW 11 30807797 missense possibly damaging 0.53
R0940:Psme4 UTSW 11 30815264 missense possibly damaging 0.53
R1018:Psme4 UTSW 11 30804310 missense probably damaging 1.00
R1312:Psme4 UTSW 11 30807687 splice site probably null
R1448:Psme4 UTSW 11 30852744 missense probably damaging 1.00
R1713:Psme4 UTSW 11 30806310 missense probably damaging 1.00
R1732:Psme4 UTSW 11 30848105 missense probably benign 0.03
R1813:Psme4 UTSW 11 30804353 missense probably benign 0.14
R1905:Psme4 UTSW 11 30810922 missense probably damaging 1.00
R1907:Psme4 UTSW 11 30810922 missense probably damaging 1.00
R1911:Psme4 UTSW 11 30815658 missense probably benign 0.02
R1956:Psme4 UTSW 11 30832424 missense probably damaging 0.99
R1974:Psme4 UTSW 11 30819011 missense probably benign 0.00
R1980:Psme4 UTSW 11 30832615 missense possibly damaging 0.84
R1986:Psme4 UTSW 11 30830352 missense probably benign 0.01
R2046:Psme4 UTSW 11 30817723 splice site probably benign
R2142:Psme4 UTSW 11 30820998 missense possibly damaging 0.89
R2698:Psme4 UTSW 11 30874282 critical splice donor site probably null
R2844:Psme4 UTSW 11 30845173 splice site probably benign
R3807:Psme4 UTSW 11 30856027 splice site probably null
R3876:Psme4 UTSW 11 30856068 missense probably damaging 0.99
R4420:Psme4 UTSW 11 30812028 missense possibly damaging 0.67
R4584:Psme4 UTSW 11 30834318 missense probably damaging 1.00
R4615:Psme4 UTSW 11 30834287 missense probably benign 0.02
R4714:Psme4 UTSW 11 30832573 missense probably benign 0.02
R5008:Psme4 UTSW 11 30856896 intron probably benign
R5109:Psme4 UTSW 11 30791095 nonsense probably null
R5155:Psme4 UTSW 11 30876806 missense probably damaging 1.00
R5199:Psme4 UTSW 11 30853272 missense probably benign 0.00
R5205:Psme4 UTSW 11 30832666 intron probably benign
R5452:Psme4 UTSW 11 30791168 missense probably benign
R5491:Psme4 UTSW 11 30815246 missense possibly damaging 0.63
R5685:Psme4 UTSW 11 30809837 missense probably damaging 0.99
R5764:Psme4 UTSW 11 30772364 intron probably benign
R5853:Psme4 UTSW 11 30791234 critical splice donor site probably null
R5865:Psme4 UTSW 11 30791993 missense possibly damaging 0.95
R5903:Psme4 UTSW 11 30841589 missense probably benign 0.28
R5927:Psme4 UTSW 11 30804294 missense possibly damaging 0.82
R6004:Psme4 UTSW 11 30856896 intron probably benign
R6102:Psme4 UTSW 11 30865567 missense probably damaging 1.00
R6247:Psme4 UTSW 11 30853245 missense possibly damaging 0.60
R6527:Psme4 UTSW 11 30832175 missense probably benign
R6750:Psme4 UTSW 11 30853203 missense probably damaging 1.00
R6885:Psme4 UTSW 11 30834307 nonsense probably null
R6939:Psme4 UTSW 11 30837291 missense probably damaging 0.99
R6945:Psme4 UTSW 11 30837437 missense probably benign 0.06
R7029:Psme4 UTSW 11 30772474 intron probably benign
R7049:Psme4 UTSW 11 30813904 splice site probably null
R7098:Psme4 UTSW 11 30850661 missense probably damaging 0.99
R7107:Psme4 UTSW 11 30848105 missense probably benign 0.03
R7223:Psme4 UTSW 11 30874226 missense probably benign 0.33
R7319:Psme4 UTSW 11 30807790 missense probably benign 0.00
R7375:Psme4 UTSW 11 30772700 splice site probably null
R7410:Psme4 UTSW 11 30815279 nonsense probably null
R7469:Psme4 UTSW 11 30802837 missense probably benign 0.20
R7651:Psme4 UTSW 11 30837334 missense probably damaging 0.98
R7679:Psme4 UTSW 11 30878425 missense probably damaging 0.99
R7681:Psme4 UTSW 11 30791975 missense possibly damaging 0.63
R7822:Psme4 UTSW 11 30874245 missense probably benign
R8013:Psme4 UTSW 11 30804320 missense probably benign 0.06
R8130:Psme4 UTSW 11 30842026 missense probably damaging 1.00
R8323:Psme4 UTSW 11 30843532 missense probably damaging 0.99
R8330:Psme4 UTSW 11 30843583 missense probably benign 0.00
R8363:Psme4 UTSW 11 30812139 missense probably damaging 1.00
R8491:Psme4 UTSW 11 30772161 missense possibly damaging 0.90
R8690:Psme4 UTSW 11 30837319 missense probably benign 0.00
R8696:Psme4 UTSW 11 30809896 missense probably damaging 0.99
R8743:Psme4 UTSW 11 30878467 missense probably damaging 1.00
R9241:Psme4 UTSW 11 30865576 missense probably damaging 1.00
V5088:Psme4 UTSW 11 30851210 missense probably benign 0.17
X0063:Psme4 UTSW 11 30832600 missense possibly damaging 0.66
Z1176:Psme4 UTSW 11 30843522 missense possibly damaging 0.87
Z1177:Psme4 UTSW 11 30806311 missense probably damaging 1.00
Z1177:Psme4 UTSW 11 30812138 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCACCAAACTTCCTGAACTG -3'
(R):5'- TTCAGGCCCTTTACAACAATCATC -3'

Sequencing Primer
(F):5'- GGTCCTAAGAATTGAACTCGGATC -3'
(R):5'- GCCCTTTACAACAATCATCTCCCAAC -3'
Posted On 2021-11-19