Incidental Mutation 'R8998:Hrg'
ID 690300
Institutional Source Beutler Lab
Gene Symbol Hrg
Ensembl Gene ENSMUSG00000022877
Gene Name histidine-rich glycoprotein
Synonyms D18020, D16JH2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.341) question?
Stock # R8998 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 22951072-22961656 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 22953705 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 88 (D88G)
Ref Sequence ENSEMBL: ENSMUSP00000023590 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023590] [ENSMUST00000232422]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000023590
AA Change: D88G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000023590
Gene: ENSMUSG00000022877
AA Change: D88G

DomainStartEndE-ValueType
CY 22 133 8.98e-4 SMART
CY 146 251 1.3e-2 SMART
low complexity region 347 417 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000232422
AA Change: D88G

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (41/41)
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation display mild monocytosis, decreased bleeding time, faster clot lysis, and abnormal blood coagulation; however, wound healing is normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aloxe3 A G 11: 69,142,225 K575R probably benign Het
Atp10b T A 11: 43,259,899 *1475R probably null Het
Baz2b T C 2: 59,969,264 D237G probably benign Het
Cacna2d4 A C 6: 119,242,915 Q215H possibly damaging Het
Capn15 G A 17: 25,963,081 R651C probably damaging Het
Ccdc28b A G 4: 129,622,678 V29A probably benign Het
Cyb5rl A G 4: 107,080,960 T170A possibly damaging Het
D330020A13Rik A G 6: 120,294,929 T189A unknown Het
Emsy C A 7: 98,619,305 V524F possibly damaging Het
Eppk1 T A 15: 76,102,736 N3315I probably damaging Het
Erich2 T G 2: 70,531,620 probably benign Het
Fkbp15 T C 4: 62,324,128 D529G probably damaging Het
Gbx2 C A 1: 89,929,023 G215V possibly damaging Het
Gzmd T A 14: 56,130,687 Y105F possibly damaging Het
Hpse G A 5: 100,692,243 T336M probably damaging Het
Kif20b G A 19: 34,936,853 probably benign Het
Kmt2a A G 9: 44,821,877 M2381T unknown Het
Krtap5-3 T A 7: 142,202,196 C257S unknown Het
Met C T 6: 17,491,535 R99W probably benign Het
Nlrp4b A G 7: 10,715,702 R611G probably null Het
Olfr1154 T A 2: 87,902,845 Y277F probably damaging Het
Olfr32 C T 2: 90,139,128 V4I probably benign Het
Olfr516 A C 7: 108,845,810 S67A probably benign Het
Olfr905 T C 9: 38,473,491 V248A probably benign Het
Papd5 A G 8: 88,250,722 H384R probably benign Het
Pclo A G 5: 14,677,496 I2123V unknown Het
Phf10 G C 17: 14,950,621 A350G probably benign Het
Pira2 T C 7: 3,842,491 Y298C probably damaging Het
Pkhd1 A T 1: 20,364,201 Y2338N probably damaging Het
Psme4 C T 11: 30,838,957 L1120F possibly damaging Het
Safb2 A T 17: 56,563,391 H934Q possibly damaging Het
Slc4a7 T A 14: 14,775,346 L884Q probably damaging Het
Smc4 A C 3: 69,027,561 probably benign Het
Spag16 T C 1: 69,896,547 V311A probably benign Het
Spert T C 14: 75,583,214 E357G probably damaging Het
Sprr2j-ps T C 3: 92,418,869 V17A unknown Het
Tenm3 T C 8: 48,276,687 Y1428C probably damaging Het
Treml2 A G 17: 48,302,747 D69G possibly damaging Het
Ttn T C 2: 76,827,933 K12368E unknown Het
Usp17le T C 7: 104,768,762 D391G probably benign Het
Usp28 G A 9: 49,037,839 R911Q probably benign Het
Wdfy3 A C 5: 101,845,192 S3274R probably benign Het
Ythdc2 T C 18: 44,864,304 V976A probably benign Het
Zfp334 A G 2: 165,381,488 S212P possibly damaging Het
Other mutations in Hrg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01150:Hrg APN 16 22959159 critical splice acceptor site probably null
IGL02795:Hrg APN 16 22957553 unclassified probably benign
R0042:Hrg UTSW 16 22961136 unclassified probably benign
R0184:Hrg UTSW 16 22953771 critical splice donor site probably null
R1147:Hrg UTSW 16 22961004 missense probably damaging 0.99
R1147:Hrg UTSW 16 22961004 missense probably damaging 0.99
R1733:Hrg UTSW 16 22951247 missense probably damaging 1.00
R1828:Hrg UTSW 16 22956103 missense probably damaging 1.00
R1919:Hrg UTSW 16 22954457 missense probably damaging 1.00
R2104:Hrg UTSW 16 22956199 missense probably benign 0.09
R2281:Hrg UTSW 16 22961309 unclassified probably benign
R2447:Hrg UTSW 16 22961148 unclassified probably benign
R3962:Hrg UTSW 16 22956075 missense possibly damaging 0.85
R3963:Hrg UTSW 16 22956075 missense possibly damaging 0.85
R4571:Hrg UTSW 16 22961222 unclassified probably benign
R4903:Hrg UTSW 16 22961151 unclassified probably benign
R4904:Hrg UTSW 16 22951250 missense probably benign 0.03
R5236:Hrg UTSW 16 22961513 unclassified probably benign
R6020:Hrg UTSW 16 22954518 missense probably damaging 1.00
R6054:Hrg UTSW 16 22953662 missense probably benign 0.05
R6207:Hrg UTSW 16 22954538 critical splice donor site probably null
R6374:Hrg UTSW 16 22960992 missense probably damaging 0.98
R7516:Hrg UTSW 16 22961298 missense unknown
R7606:Hrg UTSW 16 22951123 start codon destroyed probably null 0.01
R8190:Hrg UTSW 16 22961043 missense unknown
R8349:Hrg UTSW 16 22961536 missense unknown
R8449:Hrg UTSW 16 22961536 missense unknown
R8973:Hrg UTSW 16 22959218 missense probably benign 0.22
R9334:Hrg UTSW 16 22961311 missense unknown
Z1177:Hrg UTSW 16 22953712 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAAGGGAAAGGAAGATATTGCTTTT -3'
(R):5'- CCAGCATCTTTTCCCATTGTGG -3'

Sequencing Primer
(F):5'- GAGGACCCAGGTTCAATTTCCAG -3'
(R):5'- CATTGTGGTAGCCCAGCATG -3'
Posted On 2021-11-19